How to skip a line !
 

Hi :-|

I am workning on a projekt based on DNA sequences in Perl. I wanna make a program that reverse complements the DNA sequence and writes it into a file fx. revdna.fsa (Which I have done ) but the problem is that I want to keep the first unaltered because it's just a description line and therefore has to stay that way even though I change the lines after it.
Also If I wanna keep the first line AND add some more text to the first line-how do I do that???

This is a DNA seqeunce taken from the GenBank database. (the first line is not part of the sequence and is the line I wanna keep as it is)

>AB000410 1559 bp mRNA Homo sapiens
GAGAAGATAAGTCGCAAGGAGGGGGCGGGACCCACACCTCAGGAAAGCCGGAGAATTGGG
GCACGCAAGCGGGGGGGCTTTGATGACCCCCCAAAGGGCGAGGCATGCAGGAGGTGGAGG
AATTAAGTGAAACAGGGAAGGTTGTTAAACAGCACCGTGTGGGCGAGGCCTTAAGGGTCG
TGGTCCTCGTCTGGGCGGGGTCTTTGGGCGTCGACGAGGCCTGGTTCTGGGTAGGCGGGG
CTACTACGGGGCGGTGCCTGCTGTGGAAATGCCTGCCCGCGCGCTTCTGCCCAGGCGCAT
GGGGCATCGTACTCTAGCCTCCACTCCTGCCCTGTGGGCCTCCATCCCGTGCCCTCGCTC
TGAGCTGCGCCTGGACCTGGTTCTGCCTTCTGGACAATCTTTCCGGTGGAGGGAGCAAAG
TCCTGCACACTGGAGTGGTGTACTAGCGGATCAAGTATGGACACTGACTCAGACTGAGGA
GCAGCTCCACTGCACTGTGTACCGAGGAGACAAGAGCCAGGCTAGCAGGCCCACACCAGA
CGAGCTGGAGGCCGTGCGCAAGTACTTCCAGCTAGATGTTACCCTGGCTCAACTGTATCA
CCACTGGGGTTCCGTGGACTCCCACTTCCAAGAGGTGGCTCAGAAATTCCAAGGTGTGCG


I have done this so far:

open(IN, '<',"dna.dat") or die "Can't read file\n $!";
$dna = "";
while(defined($line=<IN>)){
chomp $line;
$dna .= $line;
}
close IN;

$cdna = "";
for($i=0; $i < length($dna); $i++){
$base =substr($dna, $i, 1);

if($base eq "A"){
$base= "T";
}
elsif($base eq "T"){
$base="A";
}
elsif($base eq "C"){
$base= "G";
}
elsif($base eq "G"){
$base= "C";
}
else {
die "Unknown base; $base\n";
}
$cdna .= $base;
}


$rdna = "";
for($i=-1; $i >= -length($cdna); $i--){

$base =substr($cdna, $i, 1);

$rdna .= $base;
}

)
print "The DNA string is now reversed complemented: $rdna\n";


__END__

here the file "dna.dat" containe the DNA sequence without the first line.

hope u can help me to skipt the first line;)

Re: How to skip a line !
 

Say your data is in a variable called $page. You can use the split function to split on the first line break only and then only apply your data processing code to the text that appears after that. Take a look at this:

@stuff = split(/\\n/, $page, 2);

You can find out how the split function works here:

http://perldoc.perl.org/functions/split.html

In the example I have given above, the data in the variable $page after the first line break is put into $stuff[1]. Remember, some characters (including \ ) have special meanings when used inside a regular expression (//) and therefore need to be escaped with a \ . It would be useful to give this page about regular expressions a good read if you haven't yet:

http://perldoc.perl.org/perlretut.html

I hope this helps.

Steven.

Re: How to skip a line !
 

#!/usr/bin/perl

use strict;

use warnings;

open(IN, '<',"dna.dat") or die "Can't read file\n $!";

my $first_line = <IN>;

my $dna = '';

while(my $line=<IN>){

   chomp $line;

   $dna .= $line;

}

close IN;

my $cdna = '';

for my $i (0 .. length($dna)-1){

   $_ = substr($dna, $i, 1);

   if (!/[TAGC]/) {die "Unkown base: '$_'\n";}

   $cdna .= ($_ eq 'A') ? 'T' : 

            ($_ eq 'T') ? 'A' :

            ($_ eq 'C') ? 'G' :

            ($_ eq 'G') ? 'C' : '';

}

my $rdna = reverse $cdna;

print "The DNA string is now reversed complemented:\n\n $first_line\n$rdna\n";

Re: How to skip a line !
 

this line:

$rdna = reverse $cdna;

should be:

my $rdna = reverse $cdna;

Re: How to skip a line !
 

Hi guys ....

Thanxs alot for ur big help!
Kevin I have tried the following but when I want to write the data into a file I get problems with displaying the first line without repeating itself for every new data line (because of loop):
How do I display the first line only once and followed by the dataset

I have tried this:

open(IN, '<',"dna.fsa") or die "Can't read file\n $!";
my $first_line = <IN>;
my $dna = '';
while(my $line=<IN>){
chomp $line;
$dna .= $line;
}
close IN;


$cdna = "";
for($i=0; $i < length($dna); $i++){
$base =substr($dna, $i, 1);

if($base eq "A"){
$base= "T";
}
elsif($base eq "T"){
$base="A";
}
elsif($base eq "C"){
$base= "G";
}
elsif($base eq "G"){
$base= "C";
}
else {
die "Unknown base; $base\n";
}
$cdna .= $base;
}

my $rdna = reverse $cdna;

substr($first_line, -1, 0)= "ComplementStrand";

open(OUT,'>' , "revdna.fsa") or die "Can't write file\n $!";

for($i=0; $i < length($rdna);$i+=60){
$base =substr($rdna, $i, 60);
print OUT "$base\n";
}
close OUT;

print "The DNA in FASTA format is now reversed complemented: \n", "$first_line $rdna\n";

as you can see here I only got the DNA sequence writing in the revdna.fsa, what should I do to display the first line followe by the given string ...!

Thanx

Re: How to skip a line !
 

print it outside the loop.

open(OUT,'>' , "revdna.fsa") or die "Can't write file\n $!";

print OUT "$first_line\n";

for($i=0; $i < length($rdna);$i+=60){

$base =substr($rdna, $i, 60);

print OUT "$base\n";

}

close OUT;

Re: How to skip a line !
 

Hmmm I had tried that, and its still wouldnt work when I nedit revdna.dat, only the sequence is showing!!!!!
the first line apperently cant be seen in the texteditor .....!

Re: How to skip a line !
 

hard to say why it's not working because in the code you posted it never prints $first_line to a file and you print to a file called "revdna.fsa" but then in your last post you mention "revdna.dat".

This line in your last code post:

substr($first_line, -1, 0)= "ComplementStrand";

is simpler written as:

$first_line .= "ComplementStrand";