No one has voted on any posts yet. Votes from other community members are used to determine a member's reputation amongst their peers.
- Interests
- Programming
Re:
Hello everyone, I am writting a code where result is not coming correct because I am not able to join 2 lines to make a single line. Please help me e.g my input file is: AATTCCGGTTT CCTTAACCCCC I want my code to first join them together as AATTCCGGTTTCCTTAACCCCC and then … | |
The quadruplex sequence of a genome looks like this Gx Ny1 Gx Ny2 Gx Ny3 Gx, where G is the Guanine base and the Ns are representing other bases. The x, y1, y2 and y3 are integer. A particular segment will be quadruplex sequence if x>=2. My question is I … | |
Hi All, I was trying to evaluate the matrix coefficient by the method of constrained least square fitting. The linear matrix differential equation looks like X'=AX, where X' and X are two vectors and A is matrix. Moreover, there is a constraint on diagonal matrix element and which is a(i,i)=-Sum(i/=j)a(i,j). … | |
Hi All, I have a problem to extract data from a text file. My file looks like *KEYWORD 10. 30. 50. 40. 50. 60. 0. 15. 25. llllllll KEYWORD 11. 31. 50. 40. 51. 60. 0. 15. 26. llllllll* My aim is to extract second datapoint by using first keyword. … | |
Hi all I want to login a machine remotely and doing some operation on the remote machine and then exit the remote machine by a unix shell script. I can login these two machines without passward. How can I do that? For example, my script is on machine1. that script … | |
diff doesn't give same output format as input. How do I get that? For example file1 contains 1 2 3 4 5 file 2 contains 4 5 diff file1 file2>file3 and file3 contains <1 <2 <3 The output is right but I don't want the symbol <. Please help me … | |
Hi All, I am looking for an algorithm/program that separates all of the data chunk i,e how many chunks are there. Moreover, that program will also be giving information of the size of the chunks and which are the elements. I am explained my problem by this following example suppose … | |
my input file contais this text DOPC 1024 PW 30903 CL- 1 arg01 1 My output file should be DOPC 1024 PW 100 CL- 10 arg01 1 I have used this following command for the single substitution and it works well. read no_water read length sed s/"PW 30903"/"PW $no_water"/ arg01.top … | |
How to save two images into two separate files using same python script. The two output images are correlation matrix and a graph. I was using matplotlib imshow(matrix, interpolation='bilinear') colorbar() savefig('/home/sudipta/Downloads/phppython/'+ filename +'.png') x = range(-width, width) plt.plot(x, avg_vec) plt.savefig('/home/sudipta/'+ filename +'plot' +'.png') The figures overlap each other when I … | |
Hi ALL, I want to analyze my data by a python script. The data are in multiple file and they are kept in different directories. Moreover, the name of the files in those directories are same but have different extension. I want to get my output just by providing a … | |
Hi all, I want to combine multiple files those are kept in a directory. Before getting the big file, I want to edit first and then combine them. For example, I have two files such as file1 and file2 in a directory, say TEST file1 contains 1 C 8.95377612903e-07 2 … | |
Suppose my long sequence looks like, 5’-AGGGTTTCCC*TGACCT*TCACTGC*AGGTCA*TGCA-3 The two italics subsequences (here within the two stars) in this long sequence are combinedly called as inverted repeat pattern. The length and the combination of the four letters such as A,T,G,C in those two subsequences will be varying. But there is a … |