sathya88

Is there any method in java to generate random number (integer, byte or float). please tell me if any i need it in my program. if possible please give full example. thanks.

is there any alternative ways to generate dynamic list in jsp ... i want to avoid jdbc connectivity code in jsp.... with out jdbc connectivity in jsp...i need to generate dynamic select list??

how to pass javascript variable value to jsp variable??? ex: <script> var name="balaji"; </script> <% String name1 = name (i need to store java script name value here.) %>

How to parse a string data " B. Prakash 98400 51038 B.M. LAL BROS., TYRjijbEALERS 3 Whites Road, Royapettoh,thennai r 600 014. Ph: 2852 4560 Fax: +91-44-2858 8306 Email: bmlalbros@etn.iiet'" conisder this is my string data and i need to fetch name, address, phone , email seperately is there any …

1.in my project...if user want to exit from the application... it first check yes no cancel option,if the user want to choose ,no or cancel button .. the application is not closed..but my problem is what code placed for no or cancel button...to prevent closing window... code is...[CODE] class wl …

hi.. am new for asp.net... tried all net solution... but nothing can work... how to print a asp.net web page????

difference between setdialogitemtext and update data??? in mFC VC++ application; both way we changing item values.. in some app one working another not working.. ex modal dialog update data not working.. any body explain???

is there possible multimedia file transfer using servlet??? is it possible????

i need some help..for vc++ 6.0 like vb inputbox...is there any inputbox available for dialog or sdi based mfc application... in vc++ is there any page navigation is possible... like vb hide or invisible...

am want to develop a file transfer program in vc++.. normal text file it is possible.. but is it can read for multimedia file.... like java here byte read is possible...

how to free memory of byte array... code[CODE]for(int j=0;j<count;j++){ buffer=null; //[COLOR="Red"]free the memory by set as a null but not working????? shows array index out of bound exception for the second time[/COLOR] buffer= new byte[size]; //byte mem alloc temp2=di.read(buffer,total,size);// read buffer total=total+temp2; fo=null; ds=null; fo= new FileOutputStream(flist[j]); ds= new DataOutputStream(fo); …

how to send mp3,avi(large) files via socket...small files with size less than 100kb is possible but how to send large file..

how to use messagedeigest class to bring security to a file...encode and decode a file... any suggestion ?????

any operation with text area is not working,,,cant find bug... [CODE]import java.io.*; import javax.swing.JMenu; import java.io.FileWriter; import javax.swing.JMenuBar; import javax.swing.JMenuItem; import javax.swing.JFrame; import javax.swing.JTextArea; import javax.swing.JSeparator; import java.awt.event.ActionListener; import java.awt.event.ActionEvent; import javax.swing.JScrollBar; //import javax.swing.JPopupMenu; import java.awt.Container; //import javax.swing.JFlowLayout; import javax.swing.JScrollPane; import java.awt.Color; import java.awt.Font; import java.awt.FlowLayout; import javax.swing.JFileChooser; import javax.swing.JColorChooser; …

is this possible create different applet page..and link with one page to another... if click button present in the one applet page... it will redirect or shown another.. (like html page ) is there anyway to create fullscreen application in java??(in applet or frame)... for connecting database applet based application …

am try to create notepad in java... menu item actionlisteners are not working...except exit... what is the problem with my code??? and is there any sequence follow... because am try to use jScrollpane the text area will be blocked??? code is.. [CODE]import javax.swing.JMenu; import javax.swing.JMenuBar; import javax.swing.JMenuItem; import javax.swing.JFrame; import …

i am not saying that all of my jar files are not working. in fact, all of them do work so far except for this one game that i've made. it runs perfectly in my editor, but its jar file will not execute. i checked its MANIFEST.mf file and the …

hi, am try to create a simple jar file... i got some error to run that jar file error =" Failed to load Main-Class manifest attribute from bala.jar" my code: [CODE]import javax.swing.JOptionPane; public class hello{ public static void main(String args[]){ String s= JOptionPane.showInputDialog("enter name plz...."); JOptionPane.showMessageDialog(null,"hello "+s); } }[/CODE] here …

i have a very long string like this: [ICODE]TGTGCAACGTATATTCCAACGAAAAACCTGGAGAAGAAAAGAATAAGTAAAATGAACTAGAGGCTGATGGCACAGTAAACACAAATGCCTGAAGTCAAAATACATTCTTTATAAGCCCAAAGCG[/ICODE] i want to convert it into array but i wanna split it by length of 5 array elements: [ICODE]array[0] = "TGTGC"; array[1] = "AACGT"; ..... array[n] = "AAGCG";[/ICODE] any idea? plz....... help thanks :)

i need to change my user id to sathya88... please change my username...

some commands working properly(notepad ,control(control panel))... but how to execute commands "dir" like that my code is ... [CODE] public class test1{ public static void main(String args[])throws Exception{ Runtime r= Runtime.getRuntime(); Process p1=r.exec("notepad");//working fine Process p2=r.exec("control");//working fine Process p3=r.exec("test1.java");//cannot run Process p4=r.exec("dir");// cannot run } } o/p: F:\studies\java\test>java test1 Exception …

how to use verbose in java program...

I want some projet title in java for mca... Pls help me,,,

Hello! I am trying to create a simple register/log in menu which allows users to enter the system using that username and password. I have already created the 'Register' section but I have difficulty linking it with the Username and Password in the 'Log in' section. Do I have to …

[code] public class exception4{ public static void method(){ try{ exception4.method2(); throw new Exception("method throw"); } catch(Exception e) { System.out.println("method Exception caught"+ e); //throw e; } } public static void method2(){ try{ throw new Exception("method2 throw"); } catch(Exception e) { System.out.println("method2 Exception caught"+ e); e.printStackTrace(); [COLOR="Red"][B]//throw e; [/B][/COLOR] [COLOR="Green"][U]if include this …

im not able to figure out the meaning of this piece of code: [code] public int void countTokens(String s) { StringTokenizer st= new StringTokenizer(); return st.countTokens(); } [/code]

explain how to pass parameter to thread??

what is correlation Exception in java??

Hi...I did some book exercices..i want to ask you are these code right or not? Question1---Write a programme to display a random choices from a set of 3 choices for breakfast.... i wrote this code... public class Exercice3_1 { public static void main(String[] args) { String breakFast = null; int …

hi... am develop simulator project...using java (java run time environment) for that can use applet method or java gui frame method.. suggest me..