Ad:

Python Discussion Thread
Marked Solved
Views: 774

Oct 27th, 2009

-2

DNA Questions

Expand Post »

def binding_locations(strA, strB):

The first parameter represents a strand of DNA. The second parameter is one strand from a recognition sequence. Return a list of all the indices where the recognition sequence appears in the DNA strand. (These are the restriction sites.) For example, if the DNA palindrome appears at the beginning of the DNA strand, then 0 would be one of the items in the returned list. Only look from left to right; don't reverse the first parameter and look backwards. str.find will probably be helpful.

Example:
the first string is 'AAAAAAAAGGTTCCGTCGAAAA' for example and the second string is 'AAAA'

---------------------------------------------

def match_enzymes(str, list, list):

The first parameter is a DNA strand; the second is a list of strings that are restriction enzyme names; and the third is a list of recognition sequences that are matched by the corresponding restriction enzymes. The first list might be ['BamHI', 'TaqI'] and the second list might be ['GGATCC', 'TCGA'], for example. Return a list of tuples where the first item of each tuple is the name of a restriction enzyme and the second item is the list of indices (in the DNA strand) of the restriction sites that the enzyme cuts.

Example:
match_enzymes("TCGAGGATCC", ['BamHI', 'TaqI'], ['GGATCC', 'TCGA'])

return [('BamHI', [4]), ('TaqI', [0])]

---------------------------------------------------------

def one_cutters(str, list, list):

The first parameter is a DNA strand; the second is a list of strings that are restriction enzyme names; and the third is a list of recognition sequences that are matched by the corresponding restriction enzymes. Return a list of tuples representing the 1-cutters for that strand. The first item of each tuple is the name of a restriction enzyme and the second item is the index (in the DNA strand) of the one restriction site that the enzyme cuts.

This function is the same as the previous match_enzymes function but instead, it will return the index of where the first cut of the DNA strand occurs.

Please help me out.

Thanks

Similar Threads

I have a few questions to be patched up can anybody get these to me ? in C++
help: string and random number generator Questions in C++
Preparing for an interview and need some questions answered in C
Wireless Questions in Networking

mms6

Reputation Points: 10

Solved Threads: 0

Newbie Poster

Offline

13 posts
since Oct 2009

Permalink

Oct 28th, 2009

-2

Re: DNA Questions

anyone plz help me out here

mms6

Reputation Points: 10

Solved Threads: 0

Newbie Poster

Offline

13 posts
since Oct 2009

Permalink

Oct 28th, 2009

Re: DNA Questions

hi
after reading the specification like 5 times here's what I came up with

first part:

Python Syntax (Toggle Plain Text)
def binding_locations( strA, strB ):
    indexes = []
    i = 0
    while i < len( strA ):
       # compare the strA cut from the index i to whatever size strB is
       # and if the strings are equal add the index to the list and increment the value of i depending on the length of strB
        if strA[ i : i + len( strB ) ] == strB:
            indexes += [ i ]
            i += len( strB ) - 1
        i += 1           #go to next index
    return indexes
def binding_locations( strA, strB ):
    indexes = []
    i = 0
    while i < len( strA ):
       # compare the strA cut from the index i to whatever size strB is
       # and if the strings are equal add the index to the list and increment the value of i depending on the length of strB
        if strA[ i : i + len( strB ) ] == strB:
            indexes += [ i ]
            i += len( strB ) - 1
        i += 1           #go to next index
    return indexes

second part:

Python Syntax (Toggle Plain Text)
def match_enzymes( strand, enzymes, recognitionSequence ):
    l = []
    # basically using the first function :)
    for i in range( len( enzymes ) ):
        indexes = binding_locations( strand, recognitionSequence[ i ] )
        l += [ ( enzymes[ i ], indexes ) ]
    return l
def match_enzymes( strand, enzymes, recognitionSequence ):
    l = []
    # basically using the first function :)
    for i in range( len( enzymes ) ):
        indexes = binding_locations( strand, recognitionSequence[ i ] )
        l += [ ( enzymes[ i ], indexes ) ]
    return l

I couldn't understand the specification for the third part if you could provide an example I'll try to help

masterofpuppets

Reputation Points: 20

Solved Threads: 74

Posting Whiz in Training

Offline

272 posts
since Jul 2009

Permalink

Oct 28th, 2009

Re: DNA Questions

P.S I tested this using your examples and here are my results:

Python Syntax (Toggle Plain Text)
>>> binding_locations( "AAAAAAAAGGTTCCGTCGAAAA", "AAAA" )
[0, 4, 18]
>>> binding_locations( "AAAAAAAAGGTTCCGTCGAAAA", "GT" )
[9, 14]
>>> match_enzymes( "TCGAGGATCC", ['BamHI', 'TaqI'], ['GGATCC', 'TCGA'] )
[('BamHI', [4]), ('TaqI', [0])]
>>>
>>> binding_locations( "AAAAAAAAGGTTCCGTCGAAAA", "AAAA" )
[0, 4, 18]
>>> binding_locations( "AAAAAAAAGGTTCCGTCGAAAA", "GT" )
[9, 14]
>>> match_enzymes( "TCGAGGATCC", ['BamHI', 'TaqI'], ['GGATCC', 'TCGA'] )
[('BamHI', [4]), ('TaqI', [0])]
>>>

masterofpuppets

Reputation Points: 20

Solved Threads: 74

Posting Whiz in Training

Offline

272 posts
since Jul 2009

Permalink

Oct 28th, 2009

Re: DNA Questions

Click to Expand / Collapse Quote originally posted by mms6 ...

anyone plz help me out here

We're not here to do your homework for you. But good job on copy-pasting your assignment.

Click to Expand / Collapse Quote originally posted by masterofpuppets ...

hi
after reading the specification like 5 times here's what I came up with

Dear MasterofPuppets,
You shouldn't be spoon feeding people looking for us to do their homework for them. Even though you provided good code, it doesn't help the OP at all because he's obviously going to just copy-paste your solutions and turn them in exactly in the same manner as he copy-pasted his assignment and posted it here.

jlm699

Reputation Points: 355

Solved Threads: 292

Veteran Poster

Offline

1,102 posts
since Jul 2008

Permalink

Oct 31st, 2009

Re: DNA Questions

If the OP has not even given an example of what has been tried, I would prod them to at least give an idea of how they would approach the solution. Then you can give hints how to proceed.

Another way to help is to give a related example that would be a part of the solution. At least this way the OP gets involved in the quest to solve the problem.

If you had fun with the challenge to solve the problem, be a little patient and don't post your solution right away.

vegaseat

Moderator

Reputation Points: 1333

Solved Threads: 1403

DaniWeb's Hypocrite

Offline

5,792 posts
since Oct 2004

This thread is solved

Either the thread starter or a moderator has marked this thread as solved. You can most likely trust the responses and answers given. There is most likely no reason for any further responses to be posted here. If you have a related question, please start a new thread in this forum instead.

This thread is more than three months old

No one has posted to this discussion for at least three months. Please let old threads die and do not reply to them unless you feel you have something new and valuable to contribute that absolutely must be added to make the discussion complete. Otherwise, please start a new thread in this forum instead.

Previous Thread in Python Forum Timeline: Line number in Tkinter Text field

Next Thread in Python Forum Timeline: Schooling scripts

DaniWeb Message

Cancel Changes

User Name
Password