954,525 Members — Technology Publication meets Social Media
Username:
Password:
Lost login information?
Have something to say? Contribute New Article Reply to this Article

Restriction site finding program

I am TRYING to write a program that finds restriction sites in a DNA file and returns a picture and information box of the enzyme which cuts it. My problems are;
a) I have no idea if my program works past opening the file directory.
b) I dont know how to iterate through the file 6 characters at a time, moving 1 character along each time. I need to do this, then use the dictionary to get the enzyme that corresponds to the found restriction site....

I have included my code so far. If someone can atleast tell me how to check if my code is working that would be PERFECT.

[code]
from Tkinter import *
from tkMessageBox import *
from tkFileDialog import *

#An example library of restriction enzymes and their recognition sites
site_enz= {'GAATTC':'EcoRI','GGATTC':'BamHI','AAGCTT':'HindIII',
'CCCGGG':'Smal','GATATC':'EcoRV'}

class RestrictionSites (object):
"""A class to find splice sites within an RNA sequence chosen by the user"""


def __init__(self, master):

self.master = master
self.frame = Frame(master)
self.frame.pack()

# selecting the image to use
self.image = PhotoImage(file="Opening Picture.gif")

# create a canvas that fits the image used
self.canvas = Canvas(self.frame,
width=self.image.width(),
height=self.image.height())
# aligning the image to the top left corner of the canvas
self.canvas.create_image(0,0, anchor=NW, image=self.image)
self.canvas.pack()
# now I want to add a button underneath, cannot but canvas and
# button on the same frame so need to create a new frame for button
self.button_panel = Frame(self.frame)
self.button_panel.pack(side=TOP)

# sets the width and position of the start button
self.start_button = Button(self.button_panel,
text="Click to upload a single stranded DNA sequence 5'-3'", width=100, command=self.startbutton)
self.start_button.pack()

def startbutton (self):
self.FindFile()
def FindFile (self):
#Save as dialog
filename = askopenfilename(parent=root,initialdir="/",title='Please select a directory')
#When I need the file I refer to this bit
my_file=open(filename,'r')
temp = my_file.read().upper()
my_file.close()


def valid_input(self):
#Checks file is a valid DNA sequence

while True:

self.file=self.FindFile()
self.file=self.file.upper()

#Only these bases allowed
good_bases = "ATCG"

temp_sequence = ''

for base in self.file:
if base in good_bases:
temp_sequence += base

self.file = temp_sequence

#Flag for error- assume OK at the start.
bad_input = False

#Check each base.
for base in self.file:

if base in good_bases:
#Ok so far, check next base.
continue
else:
#Not an RNA base, so flag the error.
bad_input= True
#Give the user the bad news
print 'Sorry - that is not a DNA sequence, please try again.'
#break from the 'for' loop
break
#By this stage the sequence has been checked.
#If all is awell, break form the 'while' loop.
if bad_input ==False:
break
#Otherwise the 'while' loop will go back for re-input.

return self.file

def find_site (self):
"""This function checks if there is a restriction site in the DNA"""
if site_enz.has_key(site)==False:

return '?'

return site_enz.get(site)

def find_rest_site( sequence, init_pos, restriction_site):

#function to find six-base restriction sites in a DNA sequence
#self.findfile is a string containing the DNA sequence
#init_pos is the position to start searching from (to start from the beginning, set it to 0)
#restriction_site is a string containing the sequence sought....
#but i need to get the site from the dictionary
#the function returns a list of positions where the restriction site was found
#if none are found then the list will be empty

list_of_sites=[]

end = len(sequence)-6

for pointer in range(init_pos, end):
sixer = self.FindFile[pointer:pointer+6]
if sixer==self.find_site:
list_of_sites.append(pointer)

print list_of_sites
return list_of_sites

#Main program
#this root widget sets the title of the screen
root = Tk()
root.title
#set this class to be an object
app= RestrictionSites(root)
#loops the class until the event happens and makes everything visible.
root.mainloop()
[code]

dreadyteddy
Newbie Poster
8 posts since Feb 2010
Reputation Points: 10
Solved Threads: 1
 

Edit: [/code] without /

I am TRYING to write a program that finds restriction sites in a DNA file and returns a picture and information box of the enzyme which cuts it. My problems are; a) I have no idea if my program works past opening the file directory. b) I dont know how to iterate through the file 6 characters at a time, moving 1 character along each time. I need to do this, then use the dictionary to get the enzyme that corresponds to the found restriction site....

I have included my code so far. If someone can atleast tell me how to check if my code is working that would be PERFECT.

from Tkinter import *
from tkMessageBox import *
from tkFileDialog import *

#An example library of restriction enzymes and their recognition sites
site_enz= {'GAATTC':'EcoRI','GGATTC':'BamHI','AAGCTT':'HindIII',
           'CCCGGG':'Smal','GATATC':'EcoRV'}

class RestrictionSites (object):
    """A class to find splice sites within an RNA sequence chosen by the user"""

    
    def __init__(self, master):

        self.master = master
        self.frame = Frame(master)
        self.frame.pack()

        # selecting the image to use
        self.image = PhotoImage(file="Opening Picture.gif")

        # create a canvas that fits the image used
        self.canvas = Canvas(self.frame,
                             width=self.image.width(),
                             height=self.image.height())
        # aligning the image to the top left corner of the canvas
        self.canvas.create_image(0,0, anchor=NW, image=self.image)
        self.canvas.pack()
        # now I want to add a button underneath, cannot but canvas and
        # button on the same frame so need to create a new frame for button
        self.button_panel = Frame(self.frame)
        self.button_panel.pack(side=TOP)

        # sets the width and position of the start button
        self.start_button = Button(self.button_panel,
                                   text="Click to upload a single stranded DNA sequence 5'-3'", width=100, command=self.startbutton)
        self.start_button.pack()

    def startbutton (self):
        self.FindFile()
    def FindFile (self):
        #Save as dialog
        filename = askopenfilename(parent=root,initialdir="/",title='Please select a directory')
        #When I need the file I refer to this bit
        my_file=open(filename,'r')
        temp = my_file.read().upper()
        my_file.close()
        
        
    def valid_input(self):
    #Checks file is a valid DNA sequence

        while True:
            
            self.file=self.FindFile()
            self.file=self.file.upper()

            #Only these bases allowed
            good_bases = "ATCG"

            temp_sequence = ''

            for base in self.file:
                if base in good_bases:
                    temp_sequence += base

            self.file = temp_sequence

            #Flag for error- assume OK at the start.
            bad_input = False

            #Check each base.
            for base in self.file:

                if base in good_bases:
                    #Ok so far, check next base.
                   continue
                else:
                    #Not an RNA base, so flag the error.
                    bad_input= True
                    #Give the user the bad news
                    print 'Sorry - that is not a DNA sequence, please try again.'
                    #break from the 'for' loop
                    break
            #By this stage the sequence has been checked.
            #If all is awell, break form the 'while' loop.
            if bad_input ==False:
                break
            #Otherwise the 'while' loop will go back for re-input.

        return self.file
            
    def find_site (self):
        """This function checks if there is a restriction site in the DNA"""
        if site_enz.has_key(site)==False:

            return '?'
        
        return site_enz.get(site)

    

    def find_rest_site( sequence, init_pos, restriction_site):

#function to find six-base restriction sites in a DNA sequence
#self.findfile is a string containing the DNA sequence
#init_pos is the position to start searching from (to start from the beginning, set it to 0)
#restriction_site is a string containing the sequence sought....
        #but i need to get the site from the dictionary
#the function returns a list of positions where the restriction site was found
#if none are found then the list will be empty
        
        list_of_sites=[]

        end = len(sequence)-6

        for pointer in range(init_pos, end):
            sixer = self.FindFile[pointer:pointer+6]
            if sixer==self.find_site:
                list_of_sites.append(pointer)

            print list_of_sites
            return list_of_sites
          



#Main program
#this root widget sets the title of the screen
root = Tk()
root.title
#set this class to be an object
app= RestrictionSites(root)
#loops the class until the event happens and makes everything visible.
root.mainloop()
pyTony
pyMod
Moderator
5,359 posts since Apr 2010
Reputation Points: 782
Solved Threads: 852
 

Thanks.

dreadyteddy
Newbie Poster
8 posts since Feb 2010
Reputation Points: 10
Solved Threads: 1
 

Could you include example input for program so maybe I could check it out
Go to Manage attachments in Advanced view and attach your file or zip it first if it is not supported type.

pyTony
pyMod
Moderator
5,359 posts since Apr 2010
Reputation Points: 782
Solved Threads: 852
 
Could you include example input for program so maybe I could check it out Go to Manage attachments in Advanced view and attach your file or zip it first if it is not supported type.

This is a short DNA file i have been using. It includes a restriction enzyme site.
Cheers for ur help! Im just a begginner and this task is tricky.

Attachments DNA.txt (0.05KB)
dreadyteddy
Newbie Poster
8 posts since Feb 2010
Reputation Points: 10
Solved Threads: 1
 
pyTony
pyMod
Moderator
5,359 posts since Apr 2010
Reputation Points: 782
Solved Threads: 852
 

Here is the place to start temp is filled, then never used. self.temp maybe?

self.start_button = Button(self.button_panel,
                                   text="Click to upload a single stranded DNA sequence 5'-3'",
                                   width=100,
                                   command=self.FindFile)
        self.start_button.pack()

    def FindFile (self):
        #Save as dialog
        filename = askopenfilename(parent=root,
                                   initialdir="/",
                                   title='Please select a directory')
        #When I need the file I refer to this bit
        my_file=open(filename,'r')
        temp = my_file.read().upper() ## temp never used !!!
        print temp
        print temp.split('-')
        my_file.close()
5'-CGATCGCTAGCTAGCTTGAATTCGACGATTTGCTAGGGCCAT -3'

["5'", 'CGATCGCTAGCTAGCTTGAATTCGACGATTTGCTAGGGCCAT ', "3'\n"]
pyTony
pyMod
Moderator
5,359 posts since Apr 2010
Reputation Points: 782
Solved Threads: 852
 

I have rewritten my program, it now opens the start picture, then the start button opens the file directory box...well its supposed to. This error message comes up. Any ideas?

>>> Exception in Tkinter callback
Traceback (most recent call last):
File "C:\Python26\lib\lib-tk\Tkinter.py", line 1410, in __call__
return self.func(*args)
File "C:\Users\Kt\Documents\Biochemistry\2204-Computer programming\Assess 3\Attempt2_widget.py", line 41, in startbutton
self.box2()
File "C:\Users\Kt\Documents\Biochemistry\2204-Computer programming\Assess 3\Attempt2_widget.py", line 80, in box2
master.config(menu=self.menubar)
NameError: global name 'master' is not defined

Here is my new code

from Tkinter import *
from tkMessageBox import * 
from tkFileDialog import *

#An example library of restriction enzymes and their recognition sites
site_enz= {'GAATTC':'EcoRI','GGATTC':'BamHI','AAGCTT':'HindIII',
           'CCCGGG':'Smal','GATATC':'EcoRV'}

class RestrictionSites (object):
    """A class to find splice sites within an RNA sequence chosen by the user"""

    
    def __init__(self, master):

        self.master = master
        self.frame = Frame(master)
        self.frame.pack()
        self.menubar = Menu(master)

        # selecting the image to use
        self.image = PhotoImage(file="Opening Picture.gif")

        # create a canvas that fits the image used
        self.canvas = Canvas(self.frame,
                             width=self.image.width(),
                             height=self.image.height())
        # aligning the image to the top left corner of the canvas
        self.canvas.create_image(0,0, anchor=NW, image=self.image)
        self.canvas.pack()
        # now I want to add a button underneath, cannot but canvas and
        # button on the same frame so need to create a new frame for button
        self.button_panel = Frame(self.frame)
        self.button_panel.pack(side=TOP)

        # sets the width and position of the start button
        self.start_button = Button(self.button_panel,
                                   text="Click to upload a single stranded DNA sequence 5'-3'", width=100, command=self.startbutton)
        self.start_button.pack()

    def startbutton (self):
        self.box2()
        
    def box2 (self):

        
        #add a text area 80 characters wide and 20 characters high
        self.text = Text(self.frame, width=80, height= 20)
        self.text.pack()

        #underneath the text area add a label and left-justify its text
        self.label= Label(self.frame, text="Please select a file containing a 5' to 3' DNA sequence. ")
        self.label.pack(side=TOP, anchor=W)

        #Cant mix packa nd grid in the same frame, so
        #underneath the label add another Frame to hold the buttons
        self.button_panel = Frame (self.frame)
        self.button_panel.pack (side=TOP)

        #Put the check button in the left part of the frame
        self.check_button = Button(self.button_panel, text="Check", width=30,
                                   command=self.check)
        self.check_button.grid (row=0, column=0, padx=20)

        #Put the translate butotn in the right part of the Frame and grey it out
        self.find_button= Button(self.button_panel, text = "Find Restriction Sites", width=30,
                                command=self.FindSite)
        self.find_button.grid (row=0, column=1, padx=20)

        #Create a pulldown menu

                                 
        self.filemenu = Menu(self.menubar,tearoff=0)
        #add menu items
        self.filemenu.add_command(label="Open", command=self.ChooseFile)
        self.filemenu.add_command(label="Exit", command=self.bye)
        #add the menu to the menu bar
        self.menubar.add_cascade(label="File", menu=self.filemenu)

        #display the menu
        master.config(menu=self.menubar)
        

    def bye(self):
        #remove the window from the screen when they click bye
        self.master.withdraw()
        #Stop the event handling loop and garbage collect
        self.master.quit()

    def key_pressed(self, event):
        # strange syntax required by Tcl
        sequence = self.text.get(1.0,END).strip()
        # note that we receive the event BEFORE it has been processed
        if event.keysym=="BackSpace" and len(sequence)<=1:
            self.check_button.config(state=DISABLED)
            self.find_button.config(state=DISABLED)
        else:
            self.check_button.config(state=NORMAL)

    def check(self):
        # strange syntax required by Tcl
        sequence = self.text.get(1.0,END).strip()
        
        # code should now validate the sequence
        while True:
            
            self.file=self.FindFile()
            self.file=self.file.upper()

            #Only these bases allowed
            good_bases = "ATCG"

            temp_sequence = ''

            for base in self.file:
                if base in good_bases:
                    temp_sequence += base

            self.file = temp_sequence

            #Flag for error- assume OK at the start.
            bad_input = False

            #Check each base.
            for base in self.file:

                if base in good_bases:
                    #Ok so far, check next base.
                   continue
                else:
                    #Not an RNA base, so flag the error.
                    bad_input= True
                    #Give the user the bad news
                    print 'Sorry - that is not a DNA sequence, please try again.'
                    #break from the 'for' loop
                    break
            #By this stage the sequence has been checked.
            #If all is awell, break form the 'while' loop.
            if bad_input ==False:
                break
            #Otherwise the 'while' loop will go back for re-input.

        return self.file
    # if it is OK, the translate button should be enabled
        self.find_button.config(state=NORMAL)
            
    def FindSite (self):
        """This function checks if there is a restriction site in the DNA"""
        if site_enz.has_key(site)==False:

            return '?'
        
        return site_enz.get(site)
        
    
    def ChooseFile (self):
        #Save as dialog
        filename = askopenfilename(parent=root,initialdir="/",title='Please select a directory')
        #When I need the file I refer to this bit
        my_file=open(filename,'r')
        temp = my_file.read().upper()
        my_file.close()

        my_sequence=''
        for base in temp:
            if base in 'AUGC':
                my_sequence += base
        self.tect.insert (INSERT, my_sequence)

    def openfile(self):

        filename = askopenfilename(parent=root,initialdir="/",title='Please select a directory')
        my_file=open(filename,'r')
        temp=my_file.readline()
        temp=my_file.read().upper()
        my_file.close()

        my_sequence=''
        for base in temp:
            if base in 'AUGC':
                my_sequence += base

        self.text.insert(INSERT, my_sequence)

    
    def find_list_site( sequence, init_pos, restriction_site):
        """find list of sites in file"""

#function to find six-base restriction sites in a DNA sequence
#self.findfile is a string containing the DNA sequence
#init_pos is the position to start searching from (to start from the beginning, set it to 0)
#restriction_site (self.find_site) is a string containing the sequence sought....
        #but i need to get the site from the dictionary
#the function returns a list of positions where the restriction site was found
#if none are found then the list will be empty

#self.FindFile is the string that you read (and filter) from the file.
#restriction_site (self.find_site) is the sequence of one of the sites in your dictionary.
#For example for EcoRI, restriction_site would be 'GAATTC'.

#You would need to run the function for each restriction site in your dictionary.
        
        list_of_sites=[]

        end = len(sequence)-6

        for pointer in range(init_pos, end):
            sixer = self.FindFile[pointer:pointer+6]
            if sixer==GAAATC:
                list_of_sites.append(pointer)

            print list_of_sites
            return list_of_sites


#Main Program for opening window
root= Tk()
root.title("Restriction Site finder")
#Set this class to be an objecy
app=RestrictionSites(root)
root.mainloop
dreadyteddy
Newbie Poster
8 posts since Feb 2010
Reputation Points: 10
Solved Threads: 1
 

This article has been dead for over three months

Post: Markdown Syntax: Formatting Help
You
View similar articles that have also been tagged: