Search DaniWeb - dna

Re: What's the most unexpected hobby or interest you have outside of coding? 2 Weeks Ago by toneewa A recent interest is the genome mapping of our DNA. The related pathways, vitamins, minerals, and 20 amino acids, associated … DNA help 14 Years Ago by babsbj Return True if the bases represented by the str parameters form a base pair and False otherwise. Each str is a single character: one of 'A', 'T', 'C', and 'G'. is_b_pair(letter,DNA): new_letter ="" new_DNA += new_letter if new_DNA in [GAATTC,AAGCTT]: return True else: return False please help DNA CHAIN 8 Years Ago by Belfina … time please!): "); longDNA = readLine("-Insert the second DNA chain(correct this time please!): "); shortDNA= shortDNA.toUpperCase(); … time please!): "); longDNA = readLine("-Insert the second DNA chain(correct this time please!): "); shortDNA= shortDNA.toUpperCase();… DNA Questions 14 Years Ago by mms6 … --------------------------------------------- def match_enzymes(str, list, list): The first parameter is a DNA strand; the second is a list of strings that are… --------------------------------------------------------- def one_cutters(str, list, list): The first parameter is a DNA strand; the second is a list of strings that are… Re: DNA CHAIN 8 Years Ago by JamesCherrill I find that code very hard to read, but looking at the matching around line 78 it looks like you are testing if the chars from the two DNA strings are the same, not T matches A etc DNA sequence and Array 4 Years Ago by Thomas_27 …size;i++) { //a switch to change the DNA to its complement switch(dnaArray[i]) { case …the arrays char displayResults() { cout << "DNA:" << endl; cout << '… = true) { cout << "The DNA strand is a palindrome." << endl; … DNA LIGATION PERL SCRIPT 11 Years Ago by jimmyali … to find solution of following problem:- input a random **DNA sequence** , cut the DNA sequence randomly into three** fragmented sequence** ,from these… fragmented sequence** retrace the DNA sequence** back . for eg. input string=AGCTAACCTTCAG fragments= TAACC,AGCT… Re: DNA help 14 Years Ago by strider1066 I'm assuming that there is some background information that a non-biologist should know before staing with the script. Is a "base pair" an AT, TA, GC, or CG? Are you to search the input strings "GAATTC", "AAGCTT" for the occurance of one of the base pairs? Binding DNA 14 Years Ago by mms6 …, strB) My specifications The first parameter represents a strand of DNA. The second parameter is one strand from a recognition sequence… all the indices where the recognition sequence appears in the DNA strand. (These are the restriction sites.) ------------------------------------------------------- For example, if the… Re: Shuffle DNA file with FASTA sequence 13 Years Ago by Anthony Cameron …G', 'T'); # Pick a random position in the DNA my($position) = randomposition($dna); #Pick a random nucleotide my ($newbase)=randomnucleotide(@nucleotides); substr… ($dna, $position, 1, $newbase); return $dna; } sub randomelement{ my(@array) = @_; return $… Re: Binding DNA 14 Years Ago by mms6 so for example: strA is 'GGTACCCCTAGG' and basically strB is return C since that where the DNA Palindrome begin str.find() can be used if someone is wondering Thanks Pairwise Comparison Of DNA Sequences function- stuck and cant find why 12 Years Ago by pwolf … exercise says the following: """ Pairwise comparision of DNA sequences is a popular technique used in Bioinformatics. It usually… the degree of similarity. Write a function that compares two DNA sequences based on the following scoring scheme: +1 for a… Security system uses database DNA 17 Years Ago by happygeek … to individual corporate databases, think of this as being database DNA if you like, which it does over time the appliance… Shuffle DNA file with FASTA sequence 13 Years Ago by Anthony Cameron … need help to fix a perl script that obtains a DNA file with a FASTA sequence and randomly shuffle the sequence… Re: Shuffle DNA file with FASTA sequence 13 Years Ago by Anthony Cameron … to use with my subroutines in order to mutate the DNA sequence and then perform the random shuffle and then calculate… Re: Shuffle DNA file with FASTA sequence 13 Years Ago by d5e5 … to use with my subroutines in order to mutate the DNA sequence and then perform the random shuffle and then calculate… how to configure AJ MATRIX DNA script on wampserver or xammp 12 Years Ago by sjparida Hi there, friends I have ajmatrix dna(multi level marketing) script written in php and MySQL, I … Re: DNA CHAIN 8 Years Ago by Belfina Well, yes true, I somehow erased the part I was "translating" the first chain. The missing code is here, but the program is still wrong: for( int i=0; i<shortDNA.length(); i++){ char ch = shortDNA.charAt(i); if (ch == 'A'){ transchain= transchain.concat("T"); }else if (ch =='T'){… Re: DNA CHAIN 8 Years Ago by JamesCherrill If you have done that translation then all you need to do the search is is longDNA.indexOf(shortDNATranslated) https://docs.oracle.com/javase/8/docs/api/java/lang/String.html#indexOf-java.lang.String- Re: DNA CHAIN 8 Years Ago by Belfina I've already tried that. Sadly, it doesn't work, I only get -1 as a result. :( Re: DNA CHAIN 8 Years Ago by JamesCherrill It does work - there's another bug in your code somewhere. Just to prove it here's an example that works (I'm not suggesting you copy this, your teacher will realise it's not your code, but proves the idea is OK) int firstDNAMatch(String shortDNA, String longDNA) { // some simple input validation... assert… Re: DNA CHAIN 8 Years Ago by Belfina Well, when I translate the line(shortDNA) I put a println method to see if it translates correctly and it indeed translates correctly, so where could the bug be. If the indexOf worked, it'd show the right index, yet it never does. Re: DNA CHAIN 8 Years Ago by Belfina I think Imight have fixed it! The method looks like this now, and it works so far. public static int findFirstMatchingPosition(String shortDNA, String longDNA){ String transchain=""; for( int i=0; i<shortDNA.length(); i++){ char ch = shortDNA.charAt(i); if (ch == 'A'){ transchain=… Re: DNA CHAIN 8 Years Ago by JamesCherrill OK! I never really doubted that Java's `indexOf` method works correctly, so it had to be something else. Your latest code looks good to me. Don't forget to mark this "solved" when you have finished testing. JC Re: DNA CHAIN 8 Years Ago by Belfina Yes, the problem was that I had typed String transchain=" "; Instead of, String transchain=""; Therefore, that messed the whole thing up! I had thought of the indeOf too, but since the code was wrong in the part I mentioned above, it didn't work. Thank you very much for your help! :3 Re: DNA Questions 14 Years Ago by mms6 anyone plz help me out here Re: DNA Questions 14 Years Ago by masterofpuppets hi after reading the specification like 5 times here's what I came up with :) first part: [CODE]def binding_locations( strA, strB ): indexes = [] i = 0 while i < len( strA ): # compare the strA cut from the index i to whatever size strB is # and if the strings are equal add the index to the list and increment … Re: DNA Questions 14 Years Ago by masterofpuppets P.S I tested this using your examples and here are my results: [CODE]>>> binding_locations( "AAAAAAAAGGTTCCGTCGAAAA", "AAAA" ) [0, 4, 18] >>> binding_locations( "AAAAAAAAGGTTCCGTCGAAAA", "GT" ) [9, 14] >>> match_enzymes( "TCGAGGATCC", ['BamHI', 'TaqI'], ['GGATCC', '… Re: DNA Questions 14 Years Ago by jlm699 [QUOTE=mms6;1029512]anyone plz help me out here[/QUOTE] We're not here to do your homework for you. But good job on copy-pasting your assignment. [QUOTE=masterofpuppets;1029534]hi after reading the specification like 5 times here's what I came up with :)[/QUOTE] Dear MasterofPuppets, You shouldn't be spoon feeding people looking for us to … Re: DNA Questions 14 Years Ago by vegaseat If the OP has not even given an example of what has been tried, I would prod them to at least give an idea of how they would approach the solution. Then you can give hints how to proceed. Another way to help is to give a related example that would be a part of the solution. At least this way the OP gets involved in the quest to solve the problem…