vbharathi

basically i am trying to search for similar strings in an array which is hardcoded into the script and compare them to and find the line they exist on the text file here is my code so far [CODE=perl] #!/usr/bin/perl %fruit=(banana=>1,apple=>2,orange=>5); $target = %fruit; open(INPUT, "<fruits.txt"); while (<INPUT>) { if …

Hallo everyone im starting to learn perl and i have a problem , i have an exercise asking me to count all the letters each apart in a DNA string , for example my @DNA =( ctagctagcatgacgatacatgacagataggatacagatagacagatacagatacagatacagatagacccatgacagatac) so i have to make a perl script showing the user how many …

Hi all, I am a perl newbie. I am using a perl code to read a column full of data from 1 field into an array [CODE]for(my $i=2;$i<table->last_record;$i++) my @data = $table->get_record($i,"Date"); [/CODE] Now for example if my @data[1] consists of list of numbers, I need to find the diff …

Hello friends , I need to parse some data from a file and arrange it in a certain file..however the file is so confusing and has such minute issues that it has really confused me now..can sumbody help. Thanks Aj I am attaching the main part of the input file …

Helllo all, well I am trying to split a file on the basis of space first and then trying to join it with "-" but i am not able to do it, can sumone please suggest what should I do in order to do it. I am attaching the required …