- Strength to Increase Rep
- +0
- Strength to Decrease Rep
- -0
- Upvotes Received
- 0
- Posts with Upvotes
- 0
- Upvoting Members
- 0
- Downvotes Received
- 1
- Posts with Downvotes
- 1
- Downvoting Members
- 1
|
Hello.. Can someone help me with this tutorial. only have a background of how to creat a dynamic array in 4 steps but not other than that. And the question seems complicated more than only that. So kindly please someone help me and wxplain it to me. --------------------- write a …
|
|
|
Re:
4 short programs
I am finishing up writing an extensive C/C++ program and am in dire need of completing these 4 short JAVA programs. Any help would be appreciated GREATLY! (I missed a few days of lecture and am extremely behind in this class.. :sad: EDIT: actually just helping me with one or … 
|
|
|
Re:
Perl
Hallo everyone im starting to learn perl and i have a problem , i have an exercise asking me to count all the letters each apart in a DNA string , for example my @DNA =( ctagctagcatgacgatacatgacagataggatacagatagacagatacagatacagatacagatagacccatgacagatac) so i have to make a perl script showing the user how many …
|