I have problem in count substring from a file that have sequence of string.After i run the code, the result should be bigger than 1 but the code still show the same result which is 1 every time i run the code.I don't know where are wrong. Any help is very appreciated.
#include <iostream>
#include <string>
#include <fstream>
#include <conio.h>
using namespace std;
int main()
{
//ifstream file;
ifstream fin;
string filename;
string s, substring;
int count = 0; // Count variable to count the number of matches within the file.
//file.open("DATA1.txt"); // Opens the file cities.txt.
string t1 = "ttt";
//cout << "Enter all or part of a city name: ";
//getline(cin,city); // User-inputted city name.
//substring = t1;
do {
cout << "Enter input data file name:";
cin >> filename; // Get the file name.
fin.open(filename.c_str()); // Convert to C-string and open it.
if (!fin) { // Will fail if didn't exist.
cout << "Unable to open " << filename << endl;
}
} while (!fin); // Continue until good file.
while (getline(fin,s)) // Read a line. If successful, enter the loop.
{
//bigstring = s;
if (s.find(t1) != -1)
{
//cout << s << endl;
}
count++;
}
cout << "There were " << count
<< " matches in the file" << endl;
getch();
return 0;
}Contains of the file are like this:
gatcctccatatacaacggtatctccacctcaggtttagatctcaacaacggaaccattgccgacatgagacagttaggtatcgtcgagagttacaagctaaaacgagcagtagtcagctctgcatctgaagccgctgaagttctactaagggtggataacatcatccgtgcaagaccaagaaccgccaatagacaacatatgtaacatatttaggatatacctcgaaaataataaaccgccacactgtcattattataattagaaacagaacgcaaaaattatccactatataattcaaagacgcgaaaaaaaaagaacaacgcgtcatagaacttttggcaattcgcgtcacaaataaattttggcaacttatgtttcctcttcgagcagtactcgagccctgtctcaagaatgtaataatacccatcgtaggtatggttaaagatagcatctccacaacctcaaagctccttgccgagagtcgccctcctttgtcgagtaattttcacttttcatatgagaacttattttcttattctttactctcacatcctgtagtgattgacactgcaacagccaccatcactagaagaacagaacaattacttaatagaaaaattatatcttcctcgaaacgatttcctgcttccaacatctacgtatatcaagaagcattcacttaccatgacacagcttcagatttcattattgctgacagctactatatcactactccat
