Pretty neat text-based RPG that I made. Currently my first game.

Member Avatar
Member Avatar
+0 forum 18

Good day IT Enthusiasts and Pros! I want to ask if any of you has an idea of making a web-based application that involves sales quotation and proposal generation? I badly need some tutorials or some pieces of advice on how to make it in PHP especially involving payments using paypal, bitpal and etc.. Some helpful codes from you might help me a lot. I've been searching over the web about source codes with no success. Please do share your ideas about this. Thank you

Member Avatar
Member Avatar
+0 forum 1

I accidentally posted a lower version of the game that had more flaws, and a few less features. This one has a few more minor bugs fixed, and a power attack instead of a normal attack.

Member Avatar
Member Avatar
+0 forum 14

Looking to test my library and implementing it so that insert function can assign the index of the rear in th e ring after the items are inserted in ring class CircularQueue: def __init__(self, size): """ ------------------------------------------------------- Initializes an empty queue. Data is stored in a list. ------------------------------------------------------- Postconditions: Initializes an empty queue. ------------------------------------------------------- """ self._values = [None] * size return def is_empty(self): """ ------------------------------------------------------- Determines if the list is empty. Use: b = l.is_empty() ------------------------------------------------------- Postconditions: Returns True if the list is empty, False otherwise. ------------------------------------------------------- """ return len(self._values) == 0 def insert(self, value): """ ------------------------------------------------------- Inserts a copy …

Member Avatar
Member Avatar
+0 forum 3

What I want to do is add items to an ArrayList then print. Each item needs to either be selectable, or non selectable. The list needs to be interactable with the arrow keys. I have the list being printed out, and thats about it. Heres my source, I have no idea what to do next. import java.util.ArrayList; import java.util.List; public class Menu { List<String> menuItems = new ArrayList<String>(); public void addItem(String menuItem, boolean selectable) { //If the Item is selectable, print ' <' beside the currently selected. //Else, make it Unselectable (Will not display ' <' beside this, instead skip) …

Member Avatar
Member Avatar
+0 forum 8

Currently I am working on a project (on and off for two months) called Chrono Leap. The main idea is that you will be able to go from the past to the present to the future whenever you want. You will face creatures and all that jazz as you go through. You have probably heard thousands of these, but I would really like it if I could get some feed back on some really disorganized code. I am not asking to organize it, but merely for others to try it out, tell me what glitches they come across and if …

Member Avatar
+0 forum 0

Hello! I am looking into game development, and recently discovered that most cube based games (with procedural generation) are coded in java, and i was wondering why that is!

Member Avatar
Member Avatar
+0 forum 2

i've been working on a game project, its a slider platformer and i've been having problem with getting the movement working, the movement is time based instead of being fixed to the frames per secound so the movement is consistent. the movement was working when i was testing out the algorithm lazily in the main file but i've put it all into a class that handles movement and collision detection and now it doesn't want to work, instead of object moving smoothly around the screen it goes flying right off the screen instead. i've tried to find the root cause …

Member Avatar
Member Avatar
+0 forum 3

hi team ... I am bachelor student i have required new web based project ideas for my final year project. I need some help..

Member Avatar
Member Avatar
+0 forum 2

So im having issues with a sorted list template, heres how I implemented it enum RelationType {LESS, EQUAL, GREATER}; template<class ItemType> struct NodeType { ItemType info; NodeType<ItemType>* next; }; template<class ItemType> class SortedType { public: SortedType(); ~SortedType(); bool IsFull() const; int GetLength() const; void MakeEmpty(); ItemType GetItem(ItemType item, bool& found); void PutItem(ItemType item); void DeleteItem(ItemType item); void ResetList(); ItemType GetNextItem(); private: NodeType<ItemType>* listData; int length; NodeType<ItemType>* currentPos; }; template<class ItemType> SortedType<ItemType>::SortedType() { length = 0; listData = NULL; } template<class ItemType> bool SortedType<ItemType>::IsFull() const {/* NodeType<ItemType>* location; try { location = new NodeType<ItemType>; delete location; return false; } catch(bad_alloc exception) …

Member Avatar
Member Avatar
+0 forum 2

Hey! I am an experienced programmer (php, javascript, mysql, some ajax) who is looking for an experienced and competent graphic and/or web designer with whom to create a text-based RPG. I will assume the financial risk and the programming responsibilities. I need someone to make the banners, logos, icons, and the layout for the game possibly including the CSS. Also looking for someone creative to help with content development (brainstorm with me to design the game). You will recieve a percentage of the profits once the game becomes profitable. If you meet this criteria and are interested please email me …

Member Avatar
Member Avatar
+0 forum 1

I am having two file (File A and File B) of sequence. In File A, thousand of sequences are in fasta format (For example:>seq1 GGTGTTTGCGTGGTTTCATGAAGGTTTTACTaTCCCGAGGAGCCTCATTAAATTGGCAAGA CTCATTAAATTGGCAAGAGGTGTTTGCGTGGTTTTGGCAAGAGGTGTTTGCGGGTTTTAAA >seq2 CTCATTAAATTGGCAAGAGGTGTTTGCGTGGTTTTGGCAAGAGGTGTTTGCGGGTTTTAAA TTTGCGTGGTTTCATGAAGGTTTTACTaTCCCGAGGAGCCTCATTAAATTGGCAAAAAAAA In File B, Two differnt things are avilable first is the sequence number i.e. >seq1 and its position number 10-120 similarly others pattern are like >seq1, 8-84 , >seq2 11-45 are avilable. I want to first search sequence file of File B i.e. >seq in File A if it is matched than extract the specific position of sequence i.e. 10-120 and get output in other file with sequence like >seq1 TTGCGTGGTTTCATGAAGGTTTTACTaTCCCGAGGAGCCTCATTAAATTGGCAAGACTCATTAAATTGGCAAGAGGTGTTTGCGTGGTTTTGG. …

Member Avatar
Member Avatar
+0 forum 2

Hey guys, im new to C++. been learning for only about a week. The most complex program i can make is a calculator! But, i was wondering, how hard would it be to make a text-based zork-like game? Like i said before im new, so any tips and/or tricks to making the code more simple would be highly appreciated. i know the more complex the more better the game will be, and the more easier it will be to modify it later on, but i dont understand much yet soo...yeah. :P

Member Avatar
Member Avatar
+0 forum 27

So I want to make a web based text game. But know nothing about coding :D I'm pretty sure php would be the best to do it in but not sure, either way were should I start?

Member Avatar
Member Avatar
+0 forum 2

hi I am interested to make a website wherein student can answer queries in MCQ format--- The requirements go like this 1. Bank PO EXAM 2. EXAM HAS 4 MODULES 3. EACH MODULE HAS MIN. 2-4 SUB-MODULES Ex English Module has 4 sub- modules.Each of them requires a different set of display. 4. ALLOW TO LOGIN,TAKE TEST posted in theri Homepage,evaluate their results Measure thier percentile system vis-a vis toal no. of test takers offer product line Parag 9819001074 **Bold Text Here**

Member Avatar
+0 forum 0

I wrote this program because I often am asked by people that know that I like to make games to make just a quick simple game for some reason or another. I always make a simple text based adventure game (like Zork, but simpler) and they are usually happy with it. Well, about 7 hours ago I was asked to make a game for somebody's birthday tomorrow, so naturally I started making yet another text based adventure game. Suddenly I realized that I basically had the code to make one of these games memorized... so I decided that enough is …

Member Avatar
+0 forum 0

Hello! I am starting a small text based game, I have created my set and get methods for my player class: import java.util.*; public class player extends main{ /* * Player attributes: * Name * Weight * Morale * Money */ //PLAYER ATTRIBUTES private String name; private int weight; private int morale; private int money; private int exp; //CREATES OBJECT OF PLAYER public player(String sName, int iWeight, int iMorale, int iMoney, int iExp) { name = sName; weight = iWeight; morale = iMorale; money = iMoney; exp = iExp; } //GET AND SET NAME public void setName(String sName) { name …

Member Avatar
Member Avatar
+0 forum 1

I need some ideas for the python text based game i am making, it looks like this so far: from time import sleep import sys #Functions set at start of code def helpme1(): for a in 'Recognised commands are: explore, help, suicide, flee, look, get,open door, run and attack. With the objects you wish to affect next to them..have fun! :)': sys.stdout.write(a) sys.stdout.flush() sleep(0.02) game() def helpme2(): for a in 'Recognised commands are: explore, help, suicide, flee, look, get, open door, run and attack. With the objects you wish to affect next to them..have fun! :)': sys.stdout.write(a) sys.stdout.flush() sleep(0.02) game2() …

Member Avatar
Member Avatar
+0 forum 4

Hi I would like to know if I can use freeswitch with PHP for voice chat. I have downloaded the freeswitch software But I am not getting how to configure php with freeswitch where to use this in freeswitch can voice chat application be created using php. how freeswitch is going to interact with php database

Member Avatar
Member Avatar
+0 forum 7

I have a simple JavaScript question. I want a drop down selection so that when you select a certain option is shows the value of the option in a div. So for example: [CODE]<select> <option value="select-1">One</option> <option value="select-2">Two</option> <option value="select-3">Three</option> </select>[/CODE] So lets say that option one is selected, then in a div somewhere else on the page "select-1" (the value of option one) would show up in that div. Same thing with all the other options. I will have a bunch of these on one page. Does anyone know how to do this? Thanks!

Member Avatar
Member Avatar
+0 forum 1

Hi everyone, recentley new to programming and the language python. So ive learned an amount of python, i decided to start a projct. My project is to make a game, which the user plays using only commands, like walk foward, open the door etc, you are in the bedroom... whatever. Ive started programming some of it but wondering how to link back to a previous line and start from there again, and also once a command has been said it can then progress onto the next stage, for example the user is sat on the bed, but stands up from …

Member Avatar
Member Avatar
+0 forum 3

Hey i'm developing a role based user authentication in my desktop application.i need to add few roles like Admin, operator, etc... i can get users role if i have user name of the logged in user.but after logging in the username cannot be retrieved again.So it has to be saved as a global variable,but since having global variable is not good for the code i want to know the best way i can create a role based authentication for my desktop application in c#. thanks in advanced.

Member Avatar
Member Avatar
+0 forum 3

HI, I would like to load a aspx page based on a session parameter. I have a "login name" in the session parameter and i want to show this aspx page if the "login name" session parameter matches a particular "login name" How can i do this? Thanks in advance.

Member Avatar
Member Avatar
+1 forum 3

This is a simple game that I am bringing to a close. It is called Slash and Smash. The goal is to defeat the last opponent, who is a champion of the arena. In the game player can use potions for health and energy,go to sleep, heal up, eat and drink, gamble, beg for money, improve level, use magic, get perks and many other things. In the final stage of programing I'll add more perks and magic, complete all 22 enemys and I will put buy and sell system for items. But before that, I ask you to help me …

Member Avatar
Member Avatar
+0 forum 10

Hi, I would like to make an Online Course Application System. I'm just wondering, what are the frameworks,technology that I need to get started? I'm thinking of using PHP and MySQL. I've used Joomla before, but for normal web page, is Joomla capable of handling such system? Thanks.

Member Avatar
Member Avatar
+0 forum 1

When a user logs in, the user is directed to a page called accountsummary.php. I have sessions enabled. I can successfully echo the inputed username, and echo the ENTIRE column of firstname and lastname for the entire table. The problem is that I do not want to echo the entire column or firstname and lastname. I only want to echo the firstname and lastname of the user name. Can anyone help with this? This is the code for the login form on the index page: <form action="scripts/loginaction.php" method="POST" name="hoapgform" id="hoapgform"><div style="width: 175px; cursor: default;" onmouseover="return window.status='WEB2: v3.0.95.0';" onmouseout="return window.status='';"> <input …

Member Avatar
Member Avatar
+0 forum 1

The End.