[position] Forum Topics

Hello everyone. I am making a game trainer in vb.net. and want to know how to write a "TEXT" wherever your cursor is. I have already found shortkey mechanism but still looking for this one. Example: I am playing game. I pressed Shift+f3 and no matter which windows is focused …

I got the insert and Delete Data/Row working for my DBMS. The deleteRow method finds the row that contains the same primary key from the database, passed on to the method, and deletes the row. With using the insertRow method, the data I added shows on up on the last …

I need a help? I m designing a webpage. I have used <**div**>s everywhere, from header to footer, moreover I have used **relative** **positioning** with **top** and **right** tag. Somewhere top value has gone -1200 and so. At last I m left with about 800px of useless area below the …

Hi :) I was wondering if anyone knows of (or has created) some type of software that could synchronise video between two remote computers (not on LAN). My internet speed is too slow to stream the actual video file, so is there some way of simply streaming the position of …

I am having two file (File A and File B) of sequence. In File A, thousand of sequences are in fasta format (For example:>seq1 GGTGTTTGCGTGGTTTCATGAAGGTTTTACTaTCCCGAGGAGCCTCATTAAATTGGCAAGA CTCATTAAATTGGCAAGAGGTGTTTGCGTGGTTTTGGCAAGAGGTGTTTGCGGGTTTTAAA >seq2 CTCATTAAATTGGCAAGAGGTGTTTGCGTGGTTTTGGCAAGAGGTGTTTGCGGGTTTTAAA TTTGCGTGGTTTCATGAAGGTTTTACTaTCCCGAGGAGCCTCATTAAATTGGCAAAAAAAA In File B, Two differnt things are avilable first is the sequence number i.e. >seq1 and its position number 10-120 similarly …

I am having trouble with stacking: [Example](http://jsfiddle.net/YMrLd/10/) I need to get **class_span** to have a higher stacking order than **class_div**. I tried to change the z-index but with no luck. Does any one know of any solutions?

Hi everyone, I have problem with links on my site ([http://troszczynka.pl](http://troszczynka.pl)). I would like to place them permanently on the top of the notebook (just like in the project: [http://troszczynka.pl/home.png](http://troszczynka.pl/home.png)) and make an animation of rolling out link with jQuery with mouse hover event. I can manage jQuery by myself …

Hi all, I am updating the position og pages, which I get dynimacally from the DB. It is d possible via the backend, for the admin of the site, to decide which position a page should have, when updating or creating a new page for the site. I let the …

Dear All, Please suppose that I have this line of code, and that my selection range goes from div element with id=1, starting at '2', to div element with id='2', ending at '8'. `<div id='1'>1`2`3</div>456<div id='2'>7`8`9</div>`. I'm using chrome, I would like to get the position of the cursor inside …

hi, i am using a div tag inside an update panel. the div tag contains a gridview which will update after some time. i have added a timer inside the update panel to update grid view. now when ever the timer of update panel gererate tick event the scrolls of …

Hi, I've got 2 forms, after click on the button I'm hiding first and showing second.. How to put the second form to the same location as first one? I've tried: MMenu m = new MMenu(); // MMenu is the first form this.Width = m.Width; //Width and Height lines are …

I am having a bit of an issue with centering images within an image rotator. The rotator is a php/jquery rotator, its very simple. the issue I am having is getting the images to be absolute middle. I have tried what seems to be everything I know, but I am …

Hello, i have never been really succesful at positioning items on a page with css, it's taken me a long time but i finally worked it out, buit for some reason with the code i am now using my border will not locate properly, i have attached an image, you …

Hi, I created a game in which players take turns entering their symbol by clicking on a box that is implemented on a grid window. I am having a hard time being able to check if the player has four symbols in a row diagonal or up or down or …

Hi all, I'm trying to get the caret position of an iframe. I tried several ways, based on this example: [url]http://stackoverflow.com/questions/8664504/designmode-iframe-get-cursor-position[/url] Anyway I try I allways get the start position of the selected text added with 19. I'm not getting why?

I would like to move the mouse cursor from one position to another within a Jtextfield after a condition is satisfied. I do not know what to use. Thank you

Hi again! I have a database and some tables filled with data. [code=c#] var club = Baza.Clubs; //Baza is dataset, and Clubs is table var schedule = Baza.Schedule; // same as above for (int i = 1; i <= 90; i++) { if(schedule[i].day == 2) // BOOM! Breaks at first …

What i am Trying to make is This [URL="http://testbox.co.cc/practice/header/topbar.jpg"]http://testbox.co.cc/practice/header/topbar.jpg[/URL] The Error i am Getting is (See the White Text) [URL="http://testbox.co.cc/practice/header/index.html"]http://testbox.co.cc/practice/header/index.html[/URL] When i add span in div and assign some property to it the text shifts a little below, i am unable to figure out why that is happening Sad i …

Hi All, I have lately encountered quite a few problems with the problem I'm about to describe. I think it would be good for all of us to know the solutions if anytime we encounter this problem. I know my content is larger than the screen and I have a …

Hello DaniWeb Users, I am new to the forum however from what I have seen it is exceptionally good! I have searched the forums already and found various questions relating to a similar problem as mine however I am unable to work out how I can amend this for my …

Hello. I'm working on a website that has pages with variable height. However, the footer is one of my main problems. When the page can be scrolled, the footer needs to be [icode]position: relative[/icode]. When the window height is greater that the page content height (no scrollbar), the footer needs …

I am able to get the competitive keywords on the 1st page of Google. But I find it very difficult to retain the keyword in the same position for sometime (two months). I am doing only White Hat SEO. I want some tips on retaining my Keyword in Google at …

Hello there, I am redesigning my website. This is the design: [URL="http://imageshack.us/photo/my-images/217/nieuwdesign.png/"]http://imageshack.us/photo/my-images/217/nieuwdesign.png/[/URL] How far I am right now, is not far enough in my eyes. The code that I am having right now is for the HTML: [CODE]<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" …

I have made a following program that will convert lower case letters in to upper case and upper case letters will remain same and that will be done Realtime (as character is typed). [CODE]#include<stdio.h> #include<conio.h> void main(void) { char ch; printf("Type a sentence: "); while (ch!='\r') { ch=getch(); if (ch …

I can't figure out why my tables are being pushed to the right so much in FireFox. Please take a look and let me know what you think the problem could be. [url]http://ground360.org/coupons/[/url] Thanks.

HTML... [CODE]<div class="title"> <h2>Texytyuyft</h2> </div>[/CODE] CSS... [CODE].title { position: absolute; height: 14%; width: 65%; left: 5%; top: 5%; background-color: #E8E8E8; z-index: 119; border-top-left-radius: 10px; border-top-right-radius: 10px; } .title h2 { position: absolute; color: #000000; z-index: 1200; }[/CODE] For some reason the text keeps going under the background. How can I …

Hi there, I'am asked for a HW write a code: * read some data of unknown number of students with their grades of 4 courses from a file * calculate the gpa, honor/warning status, and course average for each course, * write them into an output file (for testing I …

Here is my script for defining the position in C# (with XNA) [CODE] public void PositionDefinierer(int v) { positionCheck = true; if (v == 1) { v *= 0; positionCheck = false; } else { if (v < 11) { v *= 50; } else { if (v < 21) …

Edit: Nevermind I found the problem... I used the wrong comment tags (html instead of css...ack x.X). Fixed the tags and it works perfectly now. _______________ Hey everyone I need some help. I am working on a site for a class project for my web design class and it is …

Hey Guys, I've been searching a lot! and months for a solution for that specific problem !! please help . if anyone can figure it out! :S:S i have that code: [code]<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"> <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>Digital Surveillance system</title> <link rel="stylesheet" …