[size] Forum Topics

I am making a text adventure and would like the command line window to be a specific size when you run the .py file in the command line window. eg. 300 wide by 250 height. I found a thread on here that shows how to specify the text colour which …

Hi! I'm a student learning C language. During my exercise I have faced a weird problem(atleast to me). I have encountered two declarations: int size; int arr[size]; I'm unable to figure out the actual dimension of the array and its lenght as the variable `size` is only declared not defined; …

Hello good day. I am trying to figure out if it is at all possible for me to do but I want to access the area that is outside the JScrollPane's view when my JFrame is resized. Let me explain; I have a LayeredPanewith two layers within a JscrollPane. The …

Hello Community, I was wondering if there is a way to get only the visible section of the image from picturebox1 and place it in picturebox2. So what I have is picturebox1 set to a certain size, and the image size mode is set to center. Picturebox2 is also set …

I am still new to programming and hoping someone can point me in the best direction. I am creating a script that monitors a directory and creates a zip file and then mails the archive. I have successfully monitored the dir and can zip the files. I am somewhat lost …

not able to upload more then 2 mb of file in php i m using post method

Hello, I was wondering if there is a way to display formatting in a richtextbox eg. If i put **test** the word "test" would be i bold (only the word "test" and the rest would stay the normal). or if i put `test` the word "test" would be i size …

i want to create a text report and i have use this coding:- <?php $f=fopen("c:\amit.txt", "wb"); // adding header $text="\n Your text to write \n ".date('d')."-".date('m')."-".date('Y')."\n\n"; fputs($f, $text); fclose($f); ?> which results me some thing like when i open it in windows [i.e my computer->c drive->mit.txt] :- > []Your text …

I am wondering if anyone can help me or point me inthe right direction. We are currently subscribed to a company that allows us to list products onto eBay. We can upload images through their web interface. For every 10Mb of images we are charged extra. Their is a count …

Hi, I have a database called my_db1 which contains 3 tables. Out of the 3 tables one table is being populated 24*7. My hosting provider (i.e godaddy) provides 25 Mysql databases 1 GB each. What should I do if the database exceeds the 1 GB size limit? Is there a …

Hello, I'm trying to make a JPanel with JFrame capabilities, such as resizing, and moving, Everything seems to work fine, altough there are minor flickering inside the JPanel, I have numeral repaints and I have a method called update(), which uses absolute position to arrange Containers and Components. Whenever the …

Hi, I have this program that would upload files from the client to the server, Now I want to validate the filesize before uploading it into the server.. How can I create this kind of validation? Thanks.

i'm novice to this and can anybody say how to change CSS properties with javascript functions? how can i change font-sizes/font styles using a combobox represented in a textarea? [img]http://i.imgur.com/KH0om.jpg[/img] if you can show me how events working..thank you

Well I just want to know, how to give variable size for an array(Particularly, second subscript). For example, like this [CODE]#include<iostream> using namespace std; int main() { int a,b; cout<<"Enter the size for the 2D array"<<endl; cin>>a>>b; int*A=new int[a][b];[/CODE] for a its ok, But how to make it work for …

I am attempting to make my first website, however I have hit a hurdle in what appears to be browser compatability issues (or I could be talking nonsense?). I am wanting to stretch an image to act as my background of my website,the only issue is it won't work in …

Hi i have a problem in uploading large file. web hosting allow me to send file 256M, Code is working for small files but i try to upload 25M size file page return back without any error, and nothing happened. i also use "set_time_limit(0);" for unlimited request time In error …

I've been searching the internet for a way to specify the size of a component within a JPanel, but I haven't been able to find anything that has worked. The best answer I came across was to override the getPreferredSize(), getMaximumSize(), and getMinimumSize() methods of the component, but the component …

[CODE]#include<stdio.h> #include<string.h> #define SIZE 100 int main(void) { int array[SIZE], i, n, j, sum=0; printf("Enter some integers:"); for (n=0;n<100;++n) { scanf("%d", &array[n]); if(array[n] == -1) { j=n; break; } j=100; } for(j<=100;i>j;++i){ printf("%d", array[n]); } for(j=0;j<n;++j){ sum=sum+array[n]; printf("The sum is %d\n", sum); } return (0); }[/CODE] [I]Im trying to output …

Hi, I want to give a percentage for the font size. currently i'm using <h1> tag. But that text size is smaller than i need. How to make it bigger. and like i said i want to use a percentage as the size. so if i maximize my page or …

Hey all, (Skip down till "Question:" if you're in a rush) Context: I'm coding on an audio application which involves storing buffers of audio. I'm currently using a [ICODE]std::vector<float>[/ICODE], as a member of an [ICODE]AudioBuffer[/ICODE] class. These [ICODE]AudioBuffer[/ICODE] instances are held in another class [ICODE]ResourceHolder[/ICODE]. In the "process" callback (where …

i have a very long string like this: [ICODE]TGTGCAACGTATATTCCAACGAAAAACCTGGAGAAGAAAAGAATAAGTAAAATGAACTAGAGGCTGATGGCACAGTAAACACAAATGCCTGAAGTCAAAATACATTCTTTATAAGCCCAAAGCG[/ICODE] i want to convert it into array but i wanna split it by length of 5 array elements: [ICODE]array[0] = "TGTGC"; array[1] = "AACGT"; ..... array[n] = "AAGCG";[/ICODE] any idea? plz....... help thanks :)

I have a few JSpinner(s) and I'm trying to change the button sizes. I know how to change the font of the SpinnerModel(s), but not the button sizes. Can someone please point me in the right direction? TIA!

I have this script that I am using that work to upload a file and to make sure the file is either jpg, jpeg, or gif. However, I want to restrict the user with the image width no larger than 150px. Is there an easy way to implement in the …

I'm working on a CyberPet assignment and I'm not sure how to do the following: 'Then write an [ICODE]encounter ( CyberPet )[/ICODE] method that allows one CyberPet to encounter another and will describe the encounter by returning a String data type. Note that the method should take a CyberPet parameter. …

Just trying to change the formatting of various bits of my print code. Is there a simple way to do it?

im a newbie to python still so bare with me if i have gone down the wrong route or my explanation is confusing!! any ideas on how i can sort my list by the size of the file at the moment it is getting the size of the file and …

Hi guyz. I know this is a simple one but Im a bit confused in doing this. Basically, I want to get the Screen Resoultion of the client machine using my JSP. I have this code in my Bean. [CODE] Dimension screenSize = Toolkit.getDefaultToolkit().getScreenSize(); return screenSize.getWidth(); [/CODE] Problem is it …

Hi, I am new to C++ and am getting stuck with just reading in data from a text file into an array. I have looked at lots of examples online, but can't find one that matches what I am trying to do. The data consists of two variables, date and …

Dear Sir/Madam, How to measure memory consumption of a VB 6.0's programe? As a programmer in vb. 6.0, where i have to be conscious for getting less consumption of memory of my program at design time? Is there any free software to measure memory consumption of a programe? Please guide …

i need to make a paragraph of text identified by a <div> grow in size when the user moves their mouse if that portion of text. I Guess it needs to use onMouseOver and getElementById but i not sure what else is needed, i have trawled the internet for the …