44 Solved Topics
Remove Filter
|
|
|
|
Hi, how can I use regex or string replace to add missing "p" tags to sentences without tags. I tried matching* and splitting first the whole string matching "h" and "pre" tags but dont know how to merge it. `*let regexRule = /<pre>(.|\n|\r\n)[\s\S]*?<\/pre>/g;` Example - input let someVariable = "Basket … 
|
|
Hi Dw. I'm trying to read a text file. This text file has a multiply lines and what I want is that I want to separate each line or should I say I want to split each line (chop it) so that I will be able to assign these fields …
|
|
|
Hi! I am writing my own string splitter and i'm stuck. When I'm trying to split the same string the second time im getting only the first word. Im using Visual Studio 2013. "Name|Phone Number|Account Number|Price|Tariff" Output is : Name Phone Number Account Number Price Tariff Name and my desired …
|
|
so i am trying to output course information when the course number is selected and the button is clicked. here is the html <!DOCTYPE html> <html lang="en"> <head> <meta charset="utf-8"> <title>Course Info</title> </head> <body> <h1>Course Information Search</h1> <form action="" method="post"> <select name="course" id="course"> <option value="420-121">420-121</option> <option value="420-122">420-122</option> <option value="420-123">420-123</option> <option …
|
|
Im working on a code that loops through a folder break up the file names in it into specific parts and then reads off sertain parts of the broken name and writes it to a csv sile. The files ser formated as follows test_PAQT_B2H.csv, test_PAQT_B4.csv, and test_PINI_B1H.csv. when it jsut …
|
|
|
Am working on a project right now and almost stuck at a point. Say, I have a text document with contents like: `abc,123.xyz;praise;end,file,clear` Now I want abc , 123 . xyz ; praise ... in an array. I used split method with array of characters. Though I retrieved abc,123,xyz,praise,end,file,clear I … 
|
|
|
Am working on a project right now and almost stuck at a point. Say, I have a text document with contents like: `abc,123.xyz;praise;end,file,clear` Now I want abc , 123 . xyz ; praise ... in an array. I used split method with array of characters. Though I retrieved abc,123,xyz,praise,end,file,clear I …
|
|
|
I'm trying to get the time from input of html txt_URL but the array returns nothing. Not sure where I went wrong. Any help is appreciated. Thanks! **input:** Deleting 11 files. Details: Time Deleted = 01:16:30, Time Left = 00:00:00, **output:** 01:16:30 string before = txt_URL.Value; string after = Regex.Replace(before, …
|
|
hello. I need to dedupe e text. meaning if i have an array with stored strings, it will check and compare each row of array with each other to test if text[i]==text[i+1]. to dot this i thougt to catch the text from an input, ex:text are and consider it as …
|
|
Hello guys I need a favor, I have array of data fetched form mysql db and contain 4 information **id - thumb - views - added by** I want to display those arrays in 3 or 4 coloumn like picture gallery. I did it with only picture and its work …
|
|
|
Hi, I am coding some python to work with some wireless serial devices. I have 2 devices reading temperatures and other environmental data over an Xbee which then writes the data over serial. The data looks like this when read in Hex: *7e001090007d33a200408b2e0c2db7010016005763* The important character is the 7e at …
|
|
|
Hi there, how can I split a string into variables?? better: string s = "one,two,three,four"; // Split string on character comma. string[] words = s.Split(','); foreach (string word in words) { Console.WriteLine(word); } how can I put an incrasing variable (for n splitted words) instead of 'Console.WriteLine(word)' thanks 
|
|
|
Hey im just wondering if or how i can split up my services **IService** namespace Phpwcfconsole { // NOTE: You can use the "Rename" command on the "Refactor" menu to change the interface name "IService1" in both code and config file together. [ServiceContract] public interface IService { [OperationContract] string KundNyKund(Variables.Kunder …
|
|
|
I need to write a code that imports a list of files then goes through each file and rewrites only half the file. Cutting off the file at a key word. If I can make my code print the half I need I can make it write new files with …
|
|
|
My application has a lot of buttons on it, and in order to create a skin for my application, I've been just creating a lot of images in my working directory and loading them all into my application as ImageIcons. I like working with ImageIcons, but not working with a …
|
|
So i have a working network file transfer program now (if you want to see some of the code look at my other '[article](http://www.daniweb.com/software-development/java/threads/426357/networking-in-java-not-doing-it-right)'). But now that im trying larger files, im running into a problem where i run out of memory (which is understandable when the array is 1 …
|
|
**How am I going to split a line of strings ang put it into an array if the strings are arranged into columns, just like the attached file then compare the first column with user's input..? **
|
|
|
hi i have this variable which looks like this ؛‎ ‎002005 And i want to split it into two halfs three each . What i want to do is to put the first 3 numbers in a new variable and to remove its starting zero padding to get only 2 …
|
|
|
Hi All, I have to split a text into words using both spaces and punctuation as delimiters. Punctuation includes characters like .,!?:;'"- I am using the split function as it follows: [CODE]wordsArray = strLine.split("[.,!?:;'\"-]+\\s*");[/CODE] However, this only splits my text by spaces and ignores other characters I've set as delimiters. … 
|
|
Hi all, How i can split a sentences into words and add splitted words into listbox. Thank you. Best regards Eko
|
|
|
Hi, I am trying to split a single line of data into three separate parts so that they can be displayed in different textboxes. The data looks like this: item1_item2_item3 The code that I tried is: [CODE]Dim arrayLines() As String Dim record As String record = Subs.Text arrayLines = record.Split("_") …
|
|
|
I have a problem that I have been working on. I felt like I was getting close just to find out with wasn't the 100% correct way of doing it. What I need to do is take a list of names from a file in the format last, first, middle. …
|
|
|
Hey. I'm pretty new in Python. I'm trying to read from my file all the content and put it in a string. My file looks: 1 string1 2 string2 10 string 3 and I want to obtain: ["1", "string1", "2", "string 2", "10", "string3"] using this: [CODE] def read(self): file … 
|
|
|
ok, I'm pretty embarrassed to be posting such a simple question, I feel like I've done this in much harder applications like a million times... [CODE]String[] wordVar = text.split("$");[/CODE] Why does the above code not split the String 'text' at each occurrence of a "$"? Is the "$" a special …
|
|
|
so im trying to make it so that pressing enter without inputting any value, will break the loop, however, an empty string can be used because of [ICODE]for i in range(len(x_str_array)): x[i] = int(x_str_array[i]) bit.[/ICODE] [CODE] 'Exercise 7.3' # modified program from exercise 7.2 a=1 z="" while x !=z: x_str …
|
|
|
Ok, so basically I have a text file that contains the following: Resource3 "Actuator" Resource10 "Insert Exhaust Valve" Resource1 "6, 10, 18, 1" Resource21 "Emergency Stop" Resource2 "Cool Down in Progress" etc. etc. I want to read the file line by line and store it in a vector (this is …
|
|
|
Hello. I am wondering how to split a string lets say char *a="raining apples training away" using a delimiter like "g a" and the result will be: rainin pples trainin way I tried using strstr but I got stuck. Any hints will be greatly appreciated. Thank you in advance!
|
|
|
i have a very long string like this: [ICODE]TGTGCAACGTATATTCCAACGAAAAACCTGGAGAAGAAAAGAATAAGTAAAATGAACTAGAGGCTGATGGCACAGTAAACACAAATGCCTGAAGTCAAAATACATTCTTTATAAGCCCAAAGCG[/ICODE] i want to convert it into array but i wanna split it by length of 5 array elements: [ICODE]array[0] = "TGTGC"; array[1] = "AACGT"; ..... array[n] = "AAGCG";[/ICODE] any idea? plz....... help thanks :)
|
|
|
Dear all, I need your help :) i have array like this--> $myarray([0]=>a,1 [1]=>b,2 [2]=>a,2 ) i want to split each of the array element, i want to retrieve the part a and b of each array elemet and (maybe) store it in different array like this: $myarray1([0]=>a [1]=>b ) …
|
|
|
Hi Am new to this and was wondering if anyone knew a solution to this problem. I am wanting to get information from a text file into different arrays. My current text file has a new line for each driver but I would like it to look something like this: …
|
The End.