[perl] Forum Topics

I am trying to create a survey that displays only one question at a time. i have gotten it to show and store the question, but i cannot get to the next question in the survey. i know that once i get to the next question in the survey i …

I have a directory of log files - audit_20121101_010000.csv (nov 1st), audit_20121102_010000.csv (nov 2nd), audit_20121103_010000.csv (nov 3rd), audit_20121104_010000.csv (nov 4th) etc. generated on a daily basis (windows box). I am very new to perl and would like to compare the most recent file with the second most recent file on …

print "enter a number: "; $in = <>; chomp $in; print &prime($in); print "\n"; sub prime{ for($i=2;$i<($_[0]/2+1);$i++){ if($_[0]%$i ==0){return "not prime\n"} } return "prime\n"; } can anyonet tell me, what program do i use to make this code work?.. i just found it on the internet while searching a formula …

hello, Im new to PERL and I'm writing some code to compare two files lines: file 1 gets random password from a server file 2 is a test case to check that I'm getting the password with the required characteristics ( length, alnum or num) the problem that I have …

AH 1106 AH 11989 AH 121 BH 120 BH 220 CH 330 I want result like AH 1160 11989 121 BH 120 220 CH 330

Hi, I have 2 files. I need to read a line from the File 1 and check for it in File 2. If it is present, I need to delete that line from File 2. File 1 A1 B1 C1 File 2 A1 ABCDEF S1 EEE C1 EFGH D1 XYQ …

Hi all, Requirement: - I have a perl script that I need to run for several hours, for a performance test. - I would like to create a second script in ANSI C to call the perl script. The C script should be able to parse any of the text …

I have a text file containing contents like 1 A 0 -1 -2 -3 -4 2 A -1 2 3 -4 -5 So I read the file and used split function as @a=split(/ /,$_) and took each line into array a. But now when I take these into array a …

Hi, I have a sytem path like "C:\Users\ABC\XYZ\1.txt". I need to convert this to 'C:\Users\ABC\XYZ\1.txt'. Any help is appretiated. Thank you.

Hi, let say that i have this excel file that contains column of account number and the name of the customer. And I want to extract any of the data that have duplicate. And the script should be able to get the duplicate only if the both of the account …

Hello; While this script working, in case of not to connect a node ("BADYK01","BAGRK01", "BAHLK01", "BAHLK02", "BAHLK03") , it stops. I want it to be continue even if it doesnt connect a node. I mean if it couldnt connect to BAGRK01, I want it to be continue and connect the …

#!/usr/bin/perl -w use Win32::OLE qw(in with); use Win32::OLE::Const 'Microsoft Excel'; $Win32::OLE::Warn = 3; # die on errors... # get already active Excel application or open new my $Excel = Win32::OLE->GetActiveObject('Excel.Application') || Win32::OLE->new('Excel.Application', 'Quit'); # get a new workbook $book = $ex->Workbooks->Open('C:\Users\Andrew Babitt\Documents\ProductClonesTest.xls'); $Obook = $ex->Workbooks->Open('C:\Users\Andrew Babitt\Documents\NSS\extract_Products.xls'); my $billschedule = $Obook->clumn(B)->{value}; …

Hi. I am currently in a position where I am having to learn Perl in the context of developing a website using Embperl. I am at a point where I have a few subroutines that I would like to try off-loading to a separate file and then including that file …

Hi, Anyone here know how to compare the old array data from database with the new array data also from the same databse? Please help me. Its urgent.. :(

Im trying to get my program to look like the following Welcome to the 64th Primetime Emmy Awards! ============================================================================== The nominees for Outstanding Comedy Series are: [1] Write In [2] The Big Bang Theory, CBS [3] Curb Your Enthusiasm, HBO [4] Girls, HBO [5] 30 Rock, NBC [6] Veep, HBO …

Hi, I have a file containing multiple-headed data (input file 1), and also a second file containing elements for searching the first file. input file 1: UROPA sseD 1.2.3.3.3 crimson ddsU 2.1.4.1.2 green SAMEL aadH 7.4.1.1.1 blue uuoG 10.1.2.3.4 white MOONA gmaL 3.4.1.6.7 red oolJ 9.1.1.4.1 yellow input file 2: …

Hi, I need to search a particular string in a CSV file ("STPSTR01.134") the line that contains this string. I need to divide the 13th column by the 14th column. Any help would be very much appreciated. I'm using ActivePerl for windows /csv file allAssociationUtilizationData;V16SG;2012/07/27;10:45:00;STPSTR01.134;900;FALSE;SCANNER;10;3471;6288;11093;10419;588480;631296;0;254004;316732;0 allAssociationUtilizationData;V16SG;2012/07/27;10:45:00;STPSTR01.58;900;FALSE;SCANNER;10;20652;23514;39497;29404;4690132;3929776;0;3471992;2947904;0 allAssociationUtilizationData;V16SG;2012/07/27;10:45:00;STPSTR01.60;900;FALSE;SCANNER;10;20593;19351;36274;26039;4350820;3462084;0;3234956;2593056;0 allAssociationUtilizationData;V16SG;2012/07/27;10:45:00;STPSTR01.62;900;FALSE;SCANNER;10;24237;21229;40003;28678;5122408;3703840;0;3875508;2746088;0 allAssociationUtilizationData;V16SG;2012/07/27;10:45:00;STPSTR01.26;900;FALSE;SCANNER;10;18538;20644;35833;26421;4075280;3588768;0;2979124;2707892;0

Hi, I've got a set of folders with each contain many files. I need to extract a specific file extention(.sof) from each of these folders to a new directory(or the same directory in a new folder). Any help is appreciated. Thanks.

I am going to work on building a database application. One part of this is parsing pdf files which will feed the data into the database. Will be using SQLite build it C which has wrappers for Perl so there's not problem there. From what I understand, Perl is a …

I am trying to send sms through Way2sms using Perl LWP. The login part is being successful, after which I save the cookies to a local file. The welcome page after being logged in shows a Send SMS link, clicking on which one is redirected to another page with two …

I am trying to write a script to grab images from my CCD camera. I can already do this with C++ usung VFW and OpenGL, but I want to find a way to do it with Perl. It needs to be able to run on windows though. I am pretty …

I am having two file (File A and File B) of sequence. In File A, thousand of sequences are in fasta format (For example:>seq1 GGTGTTTGCGTGGTTTCATGAAGGTTTTACTaTCCCGAGGAGCCTCATTAAATTGGCAAGA CTCATTAAATTGGCAAGAGGTGTTTGCGTGGTTTTGGCAAGAGGTGTTTGCGGGTTTTAAA >seq2 CTCATTAAATTGGCAAGAGGTGTTTGCGTGGTTTTGGCAAGAGGTGTTTGCGGGTTTTAAA TTTGCGTGGTTTCATGAAGGTTTTACTaTCCCGAGGAGCCTCATTAAATTGGCAAAAAAAA In File B, Two differnt things are avilable first is the sequence number i.e. >seq1 and its position number 10-120 similarly …

Hi Daniweb, I've been using perl for Regex recently and I want to know is it possible to create an Excel Movie Library with the movie poster, the name of that file and a hyperlink of that clip is attached to the poster. Any help is appreciated. thanks.

Hello I am trying to run a perl script on tomcat server. I am putting the incoming http request in a variable data which collects the headers as well as the text file attachment data. The code is like this : .... while(<>){ $data = $data . $_ ; } …

Hi, I am trying to search for a line in a file, comment that line using a " * " and finally append the range of corresponding lines extracted from the same file. The corresponding extracted range of lines maybe present before or after the line (which is to be …

Hi, Can anyone help me in calculating the number of day between two date with this date format, YYYY-MM-DD? I am using Date::Calc qw(Add_Delta_days) but still cannot read. I got this error : -> <?xml version="1.0" encoding="UTF-8"?><soap:Envelope xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:soapenc="http://schemas.xmlsoap.org/soap/encoding/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" soap:encodingStyle="http://schemas.xmlsoap.org/soap/encoding/" xmlns:soap="http://schemas.xmlsoap.org/soap/envelope/"><soap:Body><soap:Fault><faultcode>soap:Server</faultcode><faultstring>Usage: Date::Calc::Add_Delta_Days(year, month, day, Dd) at TARGETWEBSVC.pm line 357. …

Hi Everyone, I need a perl script to create a word document in linux (in my system i have openoffice(oowriter) 1.1.5) with some text as header(left aligned) which is taken from a "file.txt". contents of the file.txt are HariKrishna 1200 Srikanth 1201 Madhav 2345 So based upon the no of …

Hi, I'd like to create a perl script that takes two input files, one being a master list of users/attributes, the other being a newly uploaded list. I'd like two output files, one being a file with new users (not in the master list) as well as updated users (changed …

Hi, suppose I have written a Perl script that creates a text file, writes something to it, and closes it. The code involves some other steps which require the download of a module from CPAN. So I do this prior to executing the code by doing something like **perl -MCPAN …

#!\strawberry\perl\bin print"Enter the number of column\n"; $r=<stdin>; print"\nEnter the numer of row\n"; $c=<stdin>; print"\neNTER THE sEQUENCE FOR THE ROW\n"; $i=0; for($j=1;$j<=$c;$j++) { $a[$i][$j]=<stdin>; } print"\neNTER THE sEQUENCE FOR THE ROW\n"; $j=0; for($i=1;$i<=$r;$i++) { $a[$i][$j]=<stdin>; } $i=0; { for($j=0;$j<=$c;$j++) { chomp $a[$i][$j]; print"\t$a[$i][$j]"; } print"\n"; } for($i=1;$i<=$r;$i++) { $j=0; { chomp …