32 Topics
| |
I am having a table with nvarchar feild in which values are entered like 1 4 8 25 I want a sql query to find the missing sequence of number in the above series... Thanks in advance... | |
I'm trying to code a program that categorized a series to be one of the following for example: 1. "demo" ; "abc" - are both hard ascending series. 2. "aabc" ; "aa" ; "zz" - are an ascending series. 3. "zzabcd" - is a non-ordered series. I wrote the following: … | |
I suppose to write a Java program using array and method follows: It reads a sequence of strings, each on a separate line, and stores them in an array, let call it input1, with one string per cell, in the order they were read. The sequence ends with an empty … | |
| The expected outcome dosent agree with result. Following is the code snippet. int a,c; a=10; c=0; c=(--a)+(--a); printf("C: %d", c); printf("\nValue of a: %d", a); I expected C to be 17 i.e (9+8), but it comes out to be 16. And a becomes 8 as expected. When expression is changed … |
var pattern =/^([0-9]{2})\/([0-9]{2})\/([0-9]{4})$/; | |
Hi, I am new to C#. Please help me to solve this problem. Given an "**input.txt**", I want to obtain the "**output.txt**" as below: **input.txt** 5,5 A(,)= 4.6; B(,)= 0.1; C(,)= 0.2; D(,)= 1.6; E(,)= 245; F(,)= 3.3; 5,15 A(,)= 6.3; B(,)= 0.9; C(,)= 0.2; D(,)= 1.6; E(,)= 242; F(,)= … | |
implement a generic fn mapf with prototype template<class Sequence c , class UnaryFunction) Sequence mapf(Sequence c , UnaryFunction f) for ex if c is a seq containing the seq (3,2,7,6,8) and f is the fn that returns twice it integer agument. then container returned by mafc(c,f) is a list containing … | |
I got a string `\x3Cb\x3EHello, World\x3C\x2Fb\x3E` as a webresponse..i think it means `<b>Hello, World</b>` but i don't know how to unescape that sequence into java string..could anyone please help me with this?? Thank you. | |
I have an array of checkbox that is populated with data from mysql database through a query. I can submit the value of the checked checkbox into a table from a database. But I want it to be saved according to the sequence the checkbox was checked by the user. … | |
Assuming i have $a='1024,1025,0000|1020,0000|'; $b='1024,1025,0000,1020,0000,'; i want replace commas (,) in $b with (|) so that $b is equal to $a like this $b='1024,1025,0000|1020,0000|'; if i use $ob=str_replace("0000,","0000|",$b); echo $ob; output works : 1024,1025,0000|1020,0000| But, how to make it with PHP where did i put that this refers to the … | |
just wrote a snippet that return true if whole image sequnce exist else returns false, import os def sequenceExists(seqPath,firstFrame,lastFrame,sep=None): """ Checks if sequence exist on disk. seqPath = image sequence path example: J:/Footages/33x01_02a/33x01_02a.%04d.sgi where %04d can be any number like 0001, 231 but not KFd001 string change buildPath at line … | |
I read the following points related to side effects in gnu c manual it is necessary for the following points to hold true between two sequence points: 1.an object may have its stored value modified at most once by the evaluation of an expression 2.the prior value of the object … | |
What would be the best way (or any way) to print out a pattern, that may cut off at any point dependant on the x & y length? for example, if i wanted a pattern 4 up (y = 4) and 14 across (x = 14) I would need it … | |
Good afternoon everyone. I need to write out a simple validation. It needs to validate only if a user enters certain keywords. Here what I have so far: if(!preg_match("Indiana, Ohio", $state)) { $errors .= "You have entered the wrong state."; } What would be the correct preg_match function to only … | |
hi does anyone know any tool that will getnerage code when the sequence dragram is there? apppreciate a reply, thanks | |
**PLEASE HELP ME. THIS CODE WILL RETRIEVE THE SEQUENCE YOU MADE. AND WILL OUTPUT IN THE TEXBOX IN THE NEXT FORM. BUT MY PROBLEM IS THAT IT DOES NOT RETRIEVE/GIVE THE GENERATED SEQUENCE. FOR SHORT NO OUTPUT T__T . PLEASE HELP.** Public Sub getJO() Dim oradb As String = "Provider=OraOLEDB.Oracle; … | |
I am having two file (File A and File B) of sequence. In File A, thousand of sequences are in fasta format (For example:>seq1 GGTGTTTGCGTGGTTTCATGAAGGTTTTACTaTCCCGAGGAGCCTCATTAAATTGGCAAGA CTCATTAAATTGGCAAGAGGTGTTTGCGTGGTTTTGGCAAGAGGTGTTTGCGGGTTTTAAA >seq2 CTCATTAAATTGGCAAGAGGTGTTTGCGTGGTTTTGGCAAGAGGTGTTTGCGGGTTTTAAA TTTGCGTGGTTTCATGAAGGTTTTACTaTCCCGAGGAGCCTCATTAAATTGGCAAAAAAAA In File B, Two differnt things are avilable first is the sequence number i.e. >seq1 and its position number 10-120 similarly … | |
I am generating the sequence 1,3,8,22,60,.... upto 10^9 the term mod of 10^9+7; However my code is giving inaccurate answers for large value of n. The formula I am using is ((1+Q)^(n+1)-(1-Q)^(n+1))/(4*Q) Here Q is sqrt (3) Here is my code.Can someone point out the error in the code or … | |
I'm writing some while loops but I feel like there is a better way to write them. [CODE]int i=3; while (i<31) { cout << i << " "; i+=3; } //this one is for the first 10 terms of a sequence starting with 3 and adding 3 each time. int … | |
I want to figure out how this loop sequence how would the computer execute this loop by going through all the steps in the picture attached. | |
This snippet defines a simple decorator to post-process a function's return value through a sequence of filters. As a first application, the decorator can transform a generator function into a function returning a sequence type (list, tuple, dict). | |
Hi i need to create about 100 files in a numbered sequence like : file1.txt,file2.txt,file3.txt . so how can i create these files using c#. | |
I want to make a Program that takes two inputs one initial number and one final number for example if I input 1 as the beginning number and 13 as the final, I would like the program to output the Fibonacci sequence: 1,1,2,3,5,8,13.. I hope someone understands it.. Pleease i … | |
Another quick code over breakfast inspired by 'spying' the other forums. | |
Hi All I have the following XML (which is generated automatically and cannot be modified): [CODE]<ExportQuery> <ELEC01_SOWaitingParts3> <OrderDtl_PartNum><![CDATA[UK MUNSTD 20 BOX OF 100]]></OrderDtl_PartNum> <JobOper_OprSeq><![CDATA[10]]></JobOper_OprSeq> <Part_PartNum><![CDATA[UK MUNSTD 20 BOX OF 100]]></Part_PartNum> <OrderDtl_OrderNum><![CDATA[18432]]></OrderDtl_OrderNum> <OrderHed_OrderNum><![CDATA[18432]]></OrderHed_OrderNum> <JobHead_PartNum><![CDATA[UK MUNSTD 20 BOX OF 100]]></JobHead_PartNum> <JobHead_JobComplete><![CDATA[Yes]]></JobHead_JobComplete> <JobOper_JobNum><![CDATA[018957]]></JobOper_JobNum> <JobOper_OpCode><![CDATA[GB STORE]]></JobOper_OpCode> <JobOper_OpDesc><![CDATA[GET BATCH STORES]]></JobOper_OpDesc> <JobOper_OpComplete><![CDATA[No]]></JobOper_OpComplete> <JobOper_QtyCompleted><![CDATA[0.00]]></JobOper_QtyCompleted> <FalseJobNum><![CDATA[18957]]></FalseJobNum> </ELEC01_SOWaitingParts3> <ELEC01_SOWaitingParts3> … | |
Hi guys, How do i extract a sequences from a fasta file by taking the start and end position from a gene predicted file: here the example the file with the orf statistics is my predicted file and for example the start position for the first orf is 65 and … | |
This snippet defines a function to merge sorted iterables containing similar items into a single iterable. Items are supposed to be sorted in ascending order. Only one item per iterable is stored at a time. | |
I was given a header file and the main files i have to create the implementation file for the header file I am issues trying to find out where I went wrong in my for loops. Can you point me in the right direction The header file [CODE]// FILE: sequence1.h … | |
| Write an assembly program, `fsm1234.asm`, that prompts the user for a number and checks it against the fsm in the figure 2. Figure 2. `L={1,2,3,4}` All numbers besides 1 must be preceded AND followed by a 1. So every 2,3 and 4 WILL have a 1 before and after it. … |
A C code is written: int i=-1 , j=-1 ,k=0 ,l=2 ,m; m=i++ && j++ && k++ || l++; //Line 3 printf("%d%d%d%d%d",i,j,k,l,m); O/p= 00131. I figured out that the Last variable in Line 3 is incremented only if it is preceeded by || else if preceeded by && it is … |
The End.