drjekil

Planning to Write a script that reads a Fasta-formatted file and writes the number of sequences in it, followed by the accessions of the sequences. For example, if the input is >Pig ACGT >Dog AGTG >Bunny TATA then the output should be 3 Pig Dog Bunny any idea?

I ve to Write a Python program that prints a random DNA sequence in Fasta format. That program should ask for the length of the sequence and suggest a reasonable sequence name. The session should look something like: > python randomdna.py Length: 34 >MySequence TGCGCATATTGTCTAACTATGGCTGTGGCCGGA The output must be in …

i have a script which will do a specific task for a file in a folder,now i would like to do the same task for the all files in that folder(25 files).how can i do that? Thanks in advance.

I am totally new in biopython and its my first program.so may be i am asking stupid question. I am working with a text filelooks like this: #NAME AA TOPO ACCESS DSSP STRIDE Z-COORD 1lghB A i 79.8 H H -24.58 1lghB V i 79.6 H H -22.06 1lghB H …

hi I am from chemistry background and no idea about programming,trying to learn biopython.Can u tell me pls which books explain things very simply? i will be greatful thanks in advance.

I am totally new in biopython and its my first program.so may be i am asking stupid question. I am working with a text filelooks like this: #NAME AA TOPO ACCESS DSSP STRIDE Z-COORD 1lghB A i 79.8 H H -24.58 1lghB V i 79.6 H H -22.06 1lghB H …

I am totally new in biopython and its my first program.so may be i am asking stupid question. I am working with a text file.Every line in that file represents one amino acid,which has some value.But i need to separate those lines which has a value between 10 to 22.how …