Joined
Last Seen
0 Reputation Points
Unknown Quality Score
No one has voted on any posts yet. Votes from other community members are used to determine a member's reputation amongst their peers.
0 Endorsements
Ranked #72.7K
 | Hallo everyone im starting to learn perl and i have a problem , i have an exercise asking me to count all the letters each apart in a DNA string , for example my @DNA =( ctagctagcatgacgatacatgacagataggatacagatagacagatacagatacagatacagatagacccatgacagatac) so i have to make a perl script showing the user how many … |