Search DaniWeb - bioperl

Bioperl on Snow Leopard 13 Years Ago by ixthy Hi everyone!!! Have somebody succesfully installed bioperl on snow leopard? I tried Fink and CPAN, but no luck. It seems impossible! Cheers!!! Re: Parsing records without using BioPerl 13 Years Ago by Anthony Cameron … for a good subroutine to parse BLAST records without using BioPerl. I have to open a BlAST results file and then… file.[/QUOTE] I understand you don't want to use BioPerl and I was searching for you but I did not… Parsing records without using BioPerl 13 Years Ago by Inking Good day, I was looking for a good subroutine to parse BLAST records without using BioPerl. I have to open a BlAST results file and then use regular expressions to parse out the query, BESTHIT (highest E-Value), E-value, and the identities. I have to parse them out and then print it out to a file. Re: Parsing records without using BioPerl 13 Years Ago by Anthony Cameron … for a good subroutine to parse BLAST records without using BioPerl. I have to open a BlAST results file and then… Confounding Regular Expression Problem 15 Years Ago by muppetjones … to search through a series of sequences read in from BioPerl (this is not the issue). The program will read in… Re: Confounding Regular Expression Problem 15 Years Ago by muppetjones … fine. So, I'm not quite sure whether it's BioPerl or something I'm doing. [code=perl]#$sequences[0] = 'AGGCCTAAACTGAAATAGTTTAG… Re: Confounding Regular Expression Problem 15 Years Ago by KevinADC … problem(s), I really have no idea. Ask on the BioPerl website or maybe someone on [url]www.perlmonks.com[/url… Parsing a text file in multiple lines 12 Years Ago by empyrean … parse EMBL format like file to fasta. i cannot use bioperl because this is not complete EMBL format. so please suggest… Re: have some problems with pattern match hope you can help!! 16 Years Ago by KevinADC … work on this kind of data, and there is also bioperl. I think it's [url]www… Re: Help with an Exception please? 16 Years Ago by KevinADC I really don't know, sorry. Find a forum or newsgroup that specializes in bioperl and you may find someone that has experienced this problem and can help. Good luck. Re: blast crashed 16 Years Ago by KevinADC I would find a BioPerl forum or mailing list and ask there. Re: Shuffle DNA file with FASTA sequence 13 Years Ago by d5e5 … your purpose. Maybe [URL="http://search.cpan.org/~birney/bioperl-run-1.4/Bio/Tools/Run/PiseApplication/fasta.pm"… Re: position specific sequence 11 Years Ago by d5e5 … at the [Bio::DB::Fasta](http://search.cpan.org/~cjfields/BioPerl-1.6.901/Bio/DB/Fasta.pm) module. I haven… Re: Confounding Regular Expression Problem 15 Years Ago by KevinADC It appears you are just running out of memory. Where the error occurs is here: symmetryfinder.pl line 183 Your regexp does not appear to be valid. I don't think you can run code inside a regexp like that. Maybe it is something new with perl 6 I am not aware of. Re: Confounding Regular Expression Problem 15 Years Ago by muppetjones So I've further isolated the problem: I believe the [icode]split[/icode] is causing the trouble, and I assume it's because of the regex nature of [icode]split[/icode]. Line 6 causes problems for some reason -- all it's doing is clearing $temp to make sure nothing is in there. Line 14 causes a [icode]panic: malloc[/icode] even when line 12 is … Re: Parsing a text file in multiple lines 12 Years Ago by thekashyap You can use sed or awk. Perhaps awk is more readable if you're new to shell scripting. Create one RE each for ID, PA, PT and Sequence. And in the body print the output. something like: [CODE]awk ' /^ID / { print $2,";" } /..../ { print ... } '[/CODE] [B]OR[/B] Start your processing with an RE that matches your …