90 Topics
| |
hi im am farely new to making websites and was looking for a few suggestions on my website. firstly i have completed make a fare structure for the home page here is the link to the image.[Click Here](http://s14.postimage.org/s6de1rfxd/cfp.png) but it looks lame as in the background makes it dull. i … | |
i want to create a text report and i have use this coding:- <?php $f=fopen("c:\amit.txt", "wb"); // adding header $text="\n Your text to write \n ".date('d')."-".date('m')."-".date('Y')."\n\n"; fputs($f, $text); fclose($f); ?> which results me some thing like when i open it in windows [i.e my computer->c drive->mit.txt] :- > []Your text … | |
I am wondering if anyone can help me or point me inthe right direction. We are currently subscribed to a company that allows us to list products onto eBay. We can upload images through their web interface. For every 10Mb of images we are charged extra. Their is a count … | |
char a[5000]; main() {} and in another file main() { char a[5000]; } after compiling both file. exe of both file size have large difference. why | |
Hello, I am currently building a rendering engine in native C++ using Direct3D 10 and the Win32 API. The engine will have 2 separate windows, one being the rendering window and the other being a control window which is used to load models, animaitons, etc. It is also used to … | |
Hi, This is pankaj, I am currently working on the printing project. Here I have creating a custom paper(height = 1000mm and width = 800mm) on the printer via code and then trying to print the text on a specific location (for example. top = 1cm and left = 1cm). … | |
Hi, I am learning queues and I have found 2 examples. Both examples represent queues with limited size, for example 30. But <queue> allows us to create queue that is not limited by ***pre-set** queue size. Can anyone explain me how have they created something like that? Thanks! ***By *pre-set* … | |
I'm curios what happens to the size of the host image after an invisible watermark has been inserted. I'm guessing the size will increase but by how much? For example, the cover image to be inserted is 1kb and the host image is 2kb. Since your adding additional information the … | |
By using the `.htaccess` file, I can make any missing image on a page be replaced with a default ‘not found’ image. However, when this is done the replacement ‘not found’ image is stretched to the dimensions of the original missing image. I was wondering if anybody has a solution … | |
Hi, I have a database called my_db1 which contains 3 tables. Out of the 3 tables one table is being populated 24*7. My hosting provider (i.e godaddy) provides 25 Mysql databases 1 GB each. What should I do if the database exceeds the 1 GB size limit? Is there a … | |
Hey all , I am working on a website on which the user has to upload images, most of the images are of large size and that takes a lot of time for the image to be uploaded, is there a way by which i can reduce the time taken … | |
Hello, for my Game I used this tutorial from riemers for automatically scalling graphics relative to the current resolution of the game window: http://www.riemers.net/eng/Tutorials/XNA/Csharp/Series2D/Resolution_independency.php If I change from the baseSize to another resolution the Mouse position gets messed up, I have a custom cursor on (int)ms.x, (int)ms.y but when I … | |
Hello, I'm trying to make a JPanel with JFrame capabilities, such as resizing, and moving, Everything seems to work fine, altough there are minor flickering inside the JPanel, I have numeral repaints and I have a method called update(), which uses absolute position to arrange Containers and Components. Whenever the … | |
Currently I have this code: [CODE]public static class SizeUnit { public static string FileSizeToString(long size) { double FileSize = size; string[] format = new string[] { "{0} bytes", "{0} KB", "{0} MB", "{0} GB", "{0} TB" }; int i = 0; while (i < format.Length && FileSize >= 1024) { … | |
Hello everybody. I've a question. I tried to change font size of textBox named "textBox1" Here is the function of the NumericUpDown: [CODE]private: System::Void numericUpDown2_ValueChanged(System::Object^ sender, System::EventArgs^ e) { String^ Num2 = this->numericUpDown2->Text; this->textBox1->Font->Size = Num2; };[/CODE] Errors that occur: [CODE] error C2039: 'set' : is not a member of … | |
Hi, I have this program that would upload files from the client to the server, Now I want to validate the filesize before uploading it into the server.. How can I create this kind of validation? Thanks. | |
Hey guys, I actually have two questions here. I've made a splitter window with two panels and set the min size to '200'. But how do I make one panel not be allowed to re-size to larger than '200'? And the second question is: if I wanted to put a … | |
i'm novice to this and can anybody say how to change CSS properties with javascript functions? how can i change font-sizes/font styles using a combobox represented in a textarea? [img]http://i.imgur.com/KH0om.jpg[/img] if you can show me how events working..thank you | |
Well I just want to know, how to give variable size for an array(Particularly, second subscript). For example, like this [CODE]#include<iostream> using namespace std; int main() { int a,b; cout<<"Enter the size for the 2D array"<<endl; cin>>a>>b; int*A=new int[a][b];[/CODE] for a its ok, But how to make it work for … | |
I am attempting to make my first website, however I have hit a hurdle in what appears to be browser compatability issues (or I could be talking nonsense?). I am wanting to stretch an image to act as my background of my website,the only issue is it won't work in … | |
Hi i have a problem in uploading large file. web hosting allow me to send file 256M, Code is working for small files but i try to upload 25M size file page return back without any error, and nothing happened. i also use "set_time_limit(0);" for unlimited request time In error … | |
I've been searching the internet for a way to specify the size of a component within a JPanel, but I haven't been able to find anything that has worked. The best answer I came across was to override the getPreferredSize(), getMaximumSize(), and getMinimumSize() methods of the component, but the component … | |
I need help with two things.... 1. I would like to lower the speed of the snake. 2. I want to make the screen, snake, and food bigger. I really need to change the speed. The 2nd thing is just something extra. But, I've tried a bunch of little things … | |
[CODE]#include<stdio.h> #include<string.h> #define SIZE 100 int main(void) { int array[SIZE], i, n, j, sum=0; printf("Enter some integers:"); for (n=0;n<100;++n) { scanf("%d", &array[n]); if(array[n] == -1) { j=n; break; } j=100; } for(j<=100;i>j;++i){ printf("%d", array[n]); } for(j=0;j<n;++j){ sum=sum+array[n]; printf("The sum is %d\n", sum); } return (0); }[/CODE] [I]Im trying to output … | |
My first thought was [CODE] int size = 0; cout << "Enter size of the array" << endl; cin >> size; int a[size]; [/CODE] Now I know that an array has to have a constant value, but I need that the user enters an integer and use that integer as … | |
Someone gave me this challenge See how large a type is by storing powers of 2 in this list of types: float, double, long double. To determine if a number will fit, start with 1.0, double it, then divide by 2 to see if you get the previous number. For … | |
Hi, I want to give a percentage for the font size. currently i'm using <h1> tag. But that text size is smaller than i need. How to make it bigger. and like i said i want to use a percentage as the size. so if i maximize my page or … | |
I am trying to find out how to replicate the output of fwrite("andbe", 4, 1, output); an encryption algorithm I am using writes its output as this, but I am sending data across a network, and need to be able to write this to a string to send. The algorithm … | |
Hey all, (Skip down till "Question:" if you're in a rush) Context: I'm coding on an audio application which involves storing buffers of audio. I'm currently using a [ICODE]std::vector<float>[/ICODE], as a member of an [ICODE]AudioBuffer[/ICODE] class. These [ICODE]AudioBuffer[/ICODE] instances are held in another class [ICODE]ResourceHolder[/ICODE]. In the "process" callback (where … | |
i have a very long string like this: [ICODE]TGTGCAACGTATATTCCAACGAAAAACCTGGAGAAGAAAAGAATAAGTAAAATGAACTAGAGGCTGATGGCACAGTAAACACAAATGCCTGAAGTCAAAATACATTCTTTATAAGCCCAAAGCG[/ICODE] i want to convert it into array but i wanna split it by length of 5 array elements: [ICODE]array[0] = "TGTGC"; array[1] = "AACGT"; ..... array[n] = "AAGCG";[/ICODE] any idea? plz....... help thanks :) |
The End.