Software Development Forum

I am trying to write a little program with a do while loop and if statements. I'm having trouble getting this to work the way I want. When I run the program, it produces two menus after making a selection. I would like it to produce one menu after making …

Hi, I have strings like this: [code] $string="OWN - NLM STAT- Publisher DA - 20091005 AU - Gannon AM AU - Turner EC AU - Reid HM AU - Kinsella BT AU- XYZ AD - UCD School of Biomolecular and Biomedical Sciences"; [/code] I want to parse these tags and …

Suppose that I have a program named myprog, and I type this in a shell [code] $ myprog -z hello -m "this is a message" [/code] The function main in myprog will receive a char** argv containing the following strings [code] "-z", "hello", "-m", "this is a message" [/code] So …

Hi All, I have written a small interactive console application to help me understand variables, when you run the application it will ask you for a length and a width and it is supposed to work out the area. It works up to the part were it is supposed to …

hello everybody, this is my first post in this forum and i hope to find help. i'm beginner in c# and i search for simple tutorials in databases access in c#.

Hi, I hav heard that it isn't that simple to write a program in linux using c. Lots of commands n stuff.Please simplify what actually I've got to do to run turbo c++ in my linux laptop as I am a beginner.

hi guys ,im trying to send serialized php object to c++ server. i dont have clear idea if it is possible to deserialize the php object in c++ code.i dont know how to convert it into c++ object and get the value out of it. when im running the server …

Hello everyone, I would like to write an application that would allow me to change the functions of the usually-useless F keys (especially F8, I hate that one) into functions that I specify in code. I would like to let some of them open certain files, or paste text.. etc …

I am a student really struggling with Java and needless to say, I am pretty isolated from anyone who gives a care enough to help me, I am on my 8th week and really struggling with GUI's I have some code written, but the gui will not display, I am …

Just like the title says. I need help on clicking on a box in a grid and filling it in with a color. Right now each block is 10x10 so I would have to use a 9x9 rectangle so it doesn't overlap. [CODE] #!/usr/bin/python import pygame,os,sys from pygame.locals import * …

I want to create a string like this: (just theoretically:-)) [CODE]import random list1 = ["1", "2", "3"] string1 = random.choice(list1) string2 = "Random Number is" + string1 [/CODE] but I want string2 to show up formatted like this: Random Number is [INDENT] 2[/INDENT] But, for the life of me I …

I have written this piece of code which removes spaces in string,its working perfectly, but the other thng that I need is to pass string to left trim function and remove spaces, the new string should returned to the main program, the new string should be passed to the right …

Here the my code( Im new to DOT NET) Im using some socket.connection with port 25. private readonly byte[] _buffer = new byte[1024]; int structId = BitConverter.ToInt32(_buffer, 0); Type currentStructType; if (!Structs.TryGetValue(structId, out currentStructType)) throw new BufferParserException(string.Format("Structure with ID = {0} is not supported.", structId)); here Im getting structId= 540029490 …

I'm selecting value from my database, passing it to datatable then giving DataGridView.DataSource value of datatable. The thing is that in those rows i'm also selecting some dates and problem is that my default date in database is '1900-01-01 00:00:00' because i use "smalldatetime". And what i want is this...when …

Hello.. Can someone help me with this tutorial. only have a background of how to creat a dynamic array in 4 steps but not other than that. And the question seems complicated more than only that. So kindly please someone help me and wxplain it to me. --------------------- write a …

I am finishing up writing an extensive C/C++ program and am in dire need of completing these 4 short JAVA programs. Any help would be appreciated GREATLY! (I missed a few days of lecture and am extremely behind in this class.. :sad: EDIT: actually just helping me with one or …

Hallo everyone im starting to learn perl and i have a problem , i have an exercise asking me to count all the letters each apart in a DNA string , for example my @DNA =( ctagctagcatgacgatacatgacagataggatacagatagacagatacagatacagatacagatagacccatgacagatac) so i have to make a perl script showing the user how many …

[B]Hi Friends Is There Any Way To Open And ReEdit An .exe File... Suppose I Have a Portable .exe File Which Needs No Installation in My Windows. And I Want To Edit Some Icons or Some Text which is Given in The .exe File So What Should I Need To …

Cheers guys, my first post here. I've been reading a lot but i can't seem to find any scenario that helps me out with my problem. I'm trying to take input from a file in the form of some shape... rectangle/square, and store it somehow. The shape is composed of …

I'm new in programming and need to validate this class email. Anybody can help? public class Email { private String email; public Email() { email = ""; } public Email(String emailAddress) { this.email = emailAddress; } public String getEmail() { return email; } public void setEmail(String email) { this.email = …

I am very poor in calculating complexities. Please some one let me know what is the complexity of the below program. I actually want to write a program for finding the nth last element with 0(n) complexity. but unable write, please give me some idea. the below code works perfectly …

N00B. If I compile a simple Hello World! program on a 64bit linux, will it work on a 32bit linux? (I'm using gcc). [CODE]#include <stdio.h> int main(void) { printf("Hello World!"); return 0; }[/CODE]

I am having a small problem... I can connect to a local MySql Database using: [CODE]SQLConn.ConnectionString = "Data Source=servername;" & _ "Initial Catalog=databasename;" & _ "User ID=username;" & _ "Password=userpassword;" [/CODE] Where servername is "localhost". I need to make a connection to an online database (same data structure). What should …

How to: 1. Buffer output ? 2. Get its size ? 3. Print the buffer ? [CODE]#include <stdio.h> int main(void) { printf("Tons of printf lines\n"); // 1. Somehow buffer the output up until this point printf("The size of the buffer is: %i\n", SIZEOFBUFFER); // 2. Get and print the size …

I don't know how to write marquee with links in java application.If someone knows, pls help me.

Hi I have a class MapMaker [CODE] class MapMaker { private: Node *grid[MAP_WIDTH][MAP_HEIGHT]; public: MapMaker(); ~MapMaker(); /*this does not work*/ Node*** getMap(int i); }; [/CODE] I need a function that returns the "grid" attribute but I do not know how. Please help me. Below is the code that implements the …

I'm having a problem implementing the complexdivbyzero exception handler. It is supposed to be triggered if the user inputs a complex number with both the real and imaginary part being zero. Any help would be appreciated. [CODE]class ComplexDivByZero{};[/CODE] [CODE]complexType complexType::operator/ (const complexType& otherComplex) const throw (ComplexDivByZero) { complexType temp; if …

i m final year student of computer engineering and there is problem for me in my final year project. i want to attach databases to sql server dbms from one of the form of my vb.net application. the idea is that a want to have a button name "Browse" when …

oldAccount text file is Nicholas, Diana, Eric,Andy, Alex , AMy CurrentAccount text file is Andy Alex Amy Kelvin cherry Betty import java.util.*; import java.io.*; public class Example2 { public static void main(String[]args) throws IOException { System.out.print (" Old Account is: "); System.out.println(); TreeSet<String> oldAcc = new TreeSet<String>(); Scanner oldacc = …

Hi there, I am new in java and some basic help would be appreciated. e.g 1-What's the out put of; double number = (1/3)*3; System.out.println("(1/3)*3 is equal to " + number); What's missing? 2- Convert each of the following mathematical formula to java expression; 3x and 3x+y Thank you in …

need to decode and encode the following text=== {Newton’s Law of Software Engineering Law 1: Every Software Engineer continues her/his state of chatting or forwarding mails unless s/he is assigned work by external unbalanced manager. Law 2: The rate of change in the software is directly proportional to the payment …

hey every one i'm new here i have visit this forum many times but today i just register i have a big big problem >__< i try to solve it but i can't its about the The Predicate Calculus this is its rule Every atomic sentence is a sentence If …

Hello, I am trying to make a GPA calculator, the code below works fine and the output is also fine the only problem is if the GPA is 4.0 or 3.0 or 2.0 or 1.0 it gives me output as 4, 3, 2, 1 i had used variable as float …

hi, i want to write code on validation of text box , combo box for make them not null fields, And other for mae a text box only accept integer , one only accept string not integer value. so pls. tell me where shud i write dis code & give …

hello i'm subhash n m persuing BCA IInd year n got an assignment of writing a program to create a binary tree n display the elements level wise ie i need to display in a form of tree. for example if elements are 6,4,8,3,5,7,9 then i need to display it …

Hi there, Trying to write a small script in python. What it will basically do is this; 1- A SSH user initiates the python script (from SSH remotely) 2- The script gets the connected users IP (the user is connected through SSH) 3- The connected IP is sent back to …

This code is just handling the SIGCHLD signal, but as you can see, the parent process should ignore this SIGCHLD signal according to the signal function. But in fact, the parent process will omit the signal function, and handling the child process using "wait". I wonder why the parent do …

I want to create a login form with password strength meter ... Please help me.

I used below code to extract year from a date object. [CODE] java.util.Date ye = new java.util.Date(); int y = ye.getYear(); System.out.println(y); [/CODE] But it prints ,109 How I get the year as 2009??

Alright.. i figured out mostly everything but my math is still screwing me up. I need to accumulate running totals for number of checks and number of deposits ;and total value of checks and total value of deposits. Im supposed to do this by looping through my arrays and this …

I have a file called file.dat and have to write a program called sdev.c which adds up all of the numbers in file.dat from each line. (Assuming that one number is per line) which has to open like this $ ./sdev < file.dat Now I can do all of the …

Last week I was goofing around with multidimensional vectors and removing an element from each row. I got my code to remove and element from each row working inside int main, but when I put all this code inside of a function I started to get errors. The common error …

Firstly ,i'm not asking about the code,i need suggestion and idea how to do it.I don't even know what should be the first thing in the main menu,because i think it is not some sort of input and output program.I thought i might relate to something like queue or stack …

Hello all, I was soooo close to nearly being done with my game..however when I added the final 'armory' loop I got an error! I took the loop out of the program, and ran it by itself, and it worked fine...yet when it is in the program it is wrong? …

hello sorry which method is the correct one we solved a question me and my friend in different methods and we went to our prof he said his method is the correct one and i couldn't get his idea so this one the first one is my way of solution …

I looked around and I didn't quite find what I was looking for. I know that to initialize an array of objects, we have to go something like this : Object *array[10]; But my question is : Why exactly can't we just go like this.. Object array[10];

I declared 4 different arrays. I dont know how to display all the arrays. Can anyone please help me with this? I want to display all 4 arrays like this: Student 1 2 3 4 5 6 7 Time Status Final 1 0 0 0 0 0 0 0 6.50 …

binding_locations(strA, strB) My specifications The first parameter represents a strand of DNA. The second parameter is one strand from a recognition sequence. Return a list of all the indices where the recognition sequence appears in the DNA strand. (These are the restriction sites.) ------------------------------------------------------- For example, if the DNA palindrome …

I've got one form in a masterpage en here i've got one asp:button with a submit function that sends data to my mail for now. And then I made a contactform in a contentpage with a asp:button.Herefore is a second submitbutton. All code behind vb.net(the function) Problem: when i click …

Hi everyone. I am so confused in input and output! I'm following what it looked to be a nice tutorial from VTC and it shows how to use scanf and printf. But i'm seeing everywhere things like printf and scanf and getc, getch, puts, gets...wtf? I learnt the diff between …