
I have the data file. txt (3.96 MB) and I want to make each 50 Character on the one line.

For EX:
In put data :

out put with 50 character on one line:

Below is my script but it take me along time to do that. Could you show me the fast way to solve this problem.

use bigint;

print "Insert the file:";
$file = <STDIN>;

if (!open (IN,"$file")){
	print "false.\n";
if (!open (OUTB, ">mode.txt")){
	print "false.\n";
if (!open (OUTC, ">mode1.txt")){
	print "false.\n";

$data = "";

while (<IN>){
	if ($_ =~ />/){
	$_ =~ s/\r//;
	$_ =~ s/\n//;
	$data = $data.$_;

$num = length($data);

for ($i = 0; $i < $num; $i++){
	$tag = substr($data, 0 + $i, 50);
	print (OUTB "$i\t$tag\n");   

print (OUTB "\n");

$data = reverse($data);

$count = 0;
$pos = 0;
$tag = "";

for ($i = 0; $i < $num + 49; $i++){
	$change = substr($data, 0 + $i, 1);
	if ($change eq "A") {
		$change =~ s/A/T/;
	elsif ($change eq "T"){
		$change =~ s/T/A/;
	elsif ($change eq "G"){
		$change =~ s/G/C/;
	elsif ($change eq "C"){
		$change =~ s/C/G/;
	$tag = $tag.$change;
	if($count == 50){
		print (OUTC "\t$tag\n"); 
		$count = 0;
		$tag = "";
		$i = $pos;
print "\ndata finished.\ncheck 「Model and model.txt.\n";
close (IN);
close (OUTB);
close (OUTC);
6 Years
Discussion Span
Last Post by d5e5
Featured Replies
  • 1
    d5e5 109   6 Years Ago

    When I tried to download your attached ref1.txt I got an error message from Daniweb saying "/tmp/Xfx9+ApI.part could not be saved, because the source file could not be read" so I can't see the data.[CODE]#!/usr/bin/perl use strict; use warnings; while(my $rec = <DATA>){ chomp($rec); $rec = reverse($rec); $rec =~ tr/ATGC/TACG/; … Read More

  • The regex engines may reduce the process time, Instead of use the 'substr' inside of the 'for' loop for this case. [CODE] #!/usr/bin/perl use strict; use warnings; my $name='GTGAGCCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCGATCTC'; my $num='50'; while($name=~ m{.{$num}}g) { print "\n\nFirst $num characters\t: $&"; my $reverse = reverse ($&); print "\nReverse $num characters\t: $reverse"; # … Read More


Suppose file.txt contains the following:

use strict;
use warnings;

my $input_filename = 'file.txt';
my $data = slurp_file($input_filename);

$data =~ s/\s//g;#Remove all space, newline, etc.
$data =~ s/(\w{50})/$1\n/g;

print $data;

sub slurp_file{
    my $filename = shift;
    local $/=undef;
    open my $fh, $filename or die "Couldn't open file: $!";
    my $string = <$fh>;
    return $string;



Thanks you very much. It work well.
I sorry I did not have the good question. I mean I find 50 chacter on on line and then try revese data. When I revese data I have to chance A=T, T=A, G=C, and C=G.

For EX: 


Reverse Data:

Edited by biojet: n/a


When I tried to download your attached ref1.txt I got an error message from Daniweb saying "/tmp/Xfx9+ApI.part could not be saved, because the source file could not be read" so I can't see the data.

use strict;
use warnings;

while(my $rec = <DATA>){
    $rec = reverse($rec);
    $rec =~ tr/ATGC/TACG/;
    print "$rec\n";

You already know how to reverse a text string. To replace A with T, T with A, etc. you could use the transliteration function $rec =~ tr/ATGC/TACG/; Since I don't get the same output you want, I may have misunderstood the question.

Edited by d5e5: n/a


hi d5e3,
Thank you very much for show me $rec =~ tr/ATGC/TACG/; I think it help me cript work fastly.

My work: 1.Find 50 base on the one line with each chacter.
2.same with 1 but with the reserve data

input: I have data with 60 chacter (1...60)
out put :
  question 1: Begin G until 50 charater.(from left to right)
              Begin C until 50 charater.(from left to right)
 question 2:  resever (input data)
              Begin T until 50 charater
              Beign G until 50 charater

my code repaired $rec =~ tr/ATGC/TACG/; below

Could you plese show me more advice to make cript run faster because my data abou 3.2MB.

use bigint; 
use strict;
use warnings;

print "Insert the file:";
my $file = <STDIN>;

if (!open (IN,"$file")){
	print "false.\n";
open (OUTB, ">mode.txt");
open (OUTC, ">mode1.txt");

my $data = "";

while (<IN>){
	if ($_ =~ />/){
	$_ =~ s/\r//;
	$_ =~ s/\n//;
	$data = $data.$_;

my $num = length($data);

for (my $i = 0; $i < $num; $i++){
	my $tag = substr($data, 0 + $i, 50);
	print (OUTB "$i\t$tag\n");   

my $data1 = reverse($data);
$data1 =~ tr/A|T|G|C/T|A|C|G/;

for (my $i = 0; $i < $num; $i++){
	my $tag = substr($data1, 0 + $i, 50);
	print (OUTC "$i\t$tag\n");   

print "\ndata finished.\ncheck 「Model and model.txt.\n";
close (IN);
close (OUTB);
close (OUTC);

Edited by biojet: n/a


Sorry, I don't know how to make your script run faster other than what I already said about slurping the file into your scalar variable instead of reading it one line at a time.

Taking 50 substrings starting at each character in a large file is probably taking most of the runtime, and I don't know a way of getting the substrings faster.


The regex engines may reduce the process time, Instead of use the 'substr' inside of the 'for' loop for this case.

use strict;
use warnings;

my $num='50';

while($name=~ m{.{$num}}g)
	print "\n\nFirst $num characters\t: $&";
	my $reverse = reverse ($&);
	print "\nReverse $num characters\t: $reverse";

	# you may print the $reverse to some file handle 
	$reverse =~ tr/A|T|G|C/T|A|C|G/;
	print "\nOutput of the sequence\t: $reverse";

	# Remove the first character of $name.
	# So $name will be reset and ready to find the next $num characters
	$name=~ s{^.}{};

Edited by k_manimuthu: n/a


Try the below code in your 3.2MB data

use strict;
use warnings;

### Inputs 
my $input='input.txt';
open (FIN, "$input") || die "Cannot open the $input file : $!";
read FIN, my $file, -s FIN;
close (FIN);

### no of occurence to match
my $num='50';

### Output
open (FOUT, ">output.txt") || die "Cannot create the output file : $!";

while($file=~ m{.{$num}}g)
	my $reverse = reverse ($&);
	$reverse =~ tr/A|T|G|C/T|A|C|G/;
	print FOUT "\n$reverse";

	# Remove the first character of $name.
	# So $name will be reset and ready to find the next $num characters
	$name=~ s{^.}{};

close (FOUT);

Edited by k_manimuthu: n/a


thank you very much. The cript work good, but with the long file it have some problems. It have a good result at first then it have the same result (about 6 times). COuld you show how to solve that problems.


I don't know, what you have some problems. But I guess you may want to process each line and create the output as the possible sequences.

use strict;
use warnings;

### Inputs 
my $input='ref1.txt';
open (FIN, "$input") || die "Cannot open the $input file : $!";

### no of occurence to match
my $num='50'; my $count=1;

### Output
open (FOUT, ">output.txt") || die "Cannot create the output file : $!";

while (<FIN>)
	my $line = $_; chomp($line);
	print FOUT "\n\nLine $count\t\t: $line"; my $seq=1;
	while($line=~ m{.{$num}}g)
		my $reverse = reverse ($&);
		$reverse =~ tr/A|T|G|C/T|A|C|G/;
		print FOUT "\nSequence $seq\t: $reverse";

		# Remove the first character of $line.
		# So $name will be reset and ready to find the next $num characters
		$line=~ s{^.}{};

close (FIN);
close (FOUT);

Thank you so much, I just add

print FOUT "\n\n first $num chaters\1:$&";

which you made at one day. It is all I hope to do and run faster.

Edited by biojet: n/a


**Deleted** (Didn't notice posts on page 2. Looks like this has already been solved).

Edited by d5e5: Please ignore the above. I posted it by mistake before seeing your post saying the script works OK now. (Mark solved?)

This question has already been answered. Start a new discussion instead.
Have something to contribute to this discussion? Please be thoughtful, detailed and courteous, and be sure to adhere to our posting rules.