I'm trying to take a file that looks like this:


And get it to look like this

I'm using a python script, so far this is what I have:


import sys

if len(sys.argv) < 2:
    print "usage: finalmyscript.py infile.txt"

fname = sys.argv[1]

handle = open(fname, "r")
list = handle.readlines()

for line in list:
    parts = line.rstrip('\n')
    linearr = parts.split()
    combine = ''.join(linearr[0])
    print combine


The script removes the '\n' at the end of each line, but it still won't join the lines all on a single line. Can anyone help with where I'm going wrong?

3 Years
Discussion Span
Last Post by HiHe
Featured Replies
  • 2

    Hint ... s = '''\ taxon1 ACCGTGGATC CCTATTGATT GGATATTATC ''' s2 = "" for ix, line in enumerate(s.split('\n')): line = line.rstrip() if ix == 0: # add a space line += ' ' s2 += line print(s2) ''' result ... taxon1 ACCGTGGATCCCTATTGATTGGATATTATC ''' Read More

  • 1

    Does the file have more than one taxon? In the example you posted there is only one so all of the solutions are for one only. Try this as a hint, although there are other ways to do it. handle = open(fname, "r") all_data = handle.read() print all_data.split("taxon") Read More

  • 2

    You can do something like that ... ''' infile_test.py data processing from a file file infile.txt has content ... taxon1 ACCGTGGATC CCTATTGATT GGATATTATC taxon2 TTCATATGTA GGATTTCATA GATGGCCCCC ''' fname = "infile.txt" with open(fname) as fin: s2 = "" for line in fin: line = line.rstrip() if "taxon" in line: # … Read More


Hint ...

s = '''\

s2 = ""
for ix, line in enumerate(s.split('\n')):
    line = line.rstrip()
    if ix == 0:
        # add a space
        line += ' '
    s2 += line


''' result ...

Edited by vegaseat


If you get rid of lines 14 - 19 you can print the input file as one line with:

print ''.join(list).replace("\n", " ")

that would work if I wasn't pulling the input from a file. I can only use the input file as a command for running my file, I can't use any of the verbatim info from the file, like the actual DNA code.

Chris, I used a line like that before, it does bring them together, but the problem is that it then puts all the taxons on one line and I need to split them by taxon.

Thank you guys!


Does the file have more than one taxon? In the example you posted there is only one so all of the solutions are for one only. Try this as a hint, although there are other ways to do it.

handle = open(fname, "r")
all_data = handle.read()
print all_data.split("taxon")

There are 3 taxon total, but I just printed 2 of them.



That last comment helped alot! Thank you! The all_data.split got all 3 taxon on one line for me.


You can do something like that ...

''' infile_test.py
data processing from a file

file infile.txt has content ...

fname = "infile.txt"

with open(fname) as fin:
    s2 = ""
    for line in fin:
        line = line.rstrip()
        if "taxon" in line:
            # add a space
            line += ' '
            # might need to adjust this value
            if len(s2) > 10:
                s2 += '\n'
        s2 += line

''' result ...

At this point it would be nice to know what your input data is. And what you expect your output data to look like.

This article has been dead for over six months. Start a new discussion instead.
Have something to contribute to this discussion? Please be thoughtful, detailed and courteous, and be sure to adhere to our posting rules.