Software Development Forum

what does it mean when while trying to run a .class file I get "Exception in thread "main" java.lang..NoSuchMethodError: main"???

i am supposed to split a string like krishnamoorthy into krishna and moorthy using operator overloading.i am unable to strike upon the logic to write a program.can u pls help me?

can u pls explain to me the use pf srand function & its syntax?i tried the following coding.it compiled,but runpage is not getting displayed. [code=cplusplus] #include<iostream.h> #include<stdlib.h> int randomno(); int main() { int i; cout<<"ten random numbers for the range 0 to 50"<<endl; for(i=0;i<10;i++) { randomno(); } return o;} int …

Help, Please help me with a program that will [U]prompt the user for the following[/U]: 1. First Name 2. Last Name [B][COLOR="BLUE"]3. Hourly or Salary a. If hourly then ask for the following i. Hours worked ii. Pay Rate 1. If the hours worked is greater than 40 hours then …

Hi, i'm a newbie to C and currently trying to learn the language, so at the moment i only really know the basic stuff. I'm trying to create a program that converts a decimal number (entered by the user) into hexidecimal. I have got it working for one single, decimal …

my output keeps putting out monday for everything need help with this, kinda confused on what im dooing [CODE]#include <iostream> #include <iomanip> using namespace std; void displayTitle(); int getMonth(int month); int getDay(int day); int getYear(int year); int CalcDayofWeek(int month, int day, int year); void displayDay(int G); int main() { //declare …

I'm almost finished with this program but the problem I'm having is with freeing the memory I allocated. Particularly in the area where I have pointers to strings. [CODE]#include <stdio.h> #include <string.h> #include <stdlib.h> /////////////// user defined data ///////////////////// struct State { char * name; // state name int year; …

Hi ? Please Help me

I've been over this all day and it looks fine to me. Yet it is crashing my program, so I know there's an error here. I'm fairly certain the error exists in the getvalue function [code] int main () { char thevalue[1024]; char needle[25]; char haystack[2048]; memset(thevalue,0,sizeof(thevalue)-1); memset(needle,0,sizeof(needle)-1); memset(haystack,0,sizeof(haystack)-1); strcpy_s(haystack, …

Is there a difference between a class and a struct? At first I thought a struct could not have methods/constructors/destructors, but now I found out they can, so what is the difference?

Hello, I am doing a file input/output. I wrote 3 fulls names, phone number, balance. etc inside my input file. Example: John Doe 555-555-5555 5000.00 In my output file, I am trying to create this output with using setw. First Name Last Name Phone Number Balance ------------ ------------ ----------------- --------- …

When I have [ICODE]sizeof(utmp)[/ICODE], 384 is returned. So when I try to find out the size of the individual members, I get a different result. Using the method below, I come up with 382 bytes. Anyone know where I'm missing the other 2 bytes? [CODE=CPP] #include <iostream> using std::cout; using …

please i am very new to all programming languagies and i have great intrest in being a sotfware developer. can you guys please tell me or give me the necessary notes. thanks

hi. i recently implemented S-DES algo. Here is the code for key generation. [code] import java.math.*; import java.security.*; public class keyGenerator { int bitLength=10; int certainty=20; int i=0,j=0,tempInt1,tempInt2; long l; byte[] actual10Key=new byte[10]; byte[] permuted10Key=new byte[10]; byte[] permuted10KeyCopy=new byte[10]; byte[] cls10Temp1=new byte[10]; byte[] subKey8Temp=new byte[8]; byte[] subKey1=new byte[8]; byte[] subKey2=new …

The following steps tell how to create a project file to play a wav sound file 1- create a project file. 2-Choose Console Application in Basic tab. 3-After Create the Project File go to Project Option 4-Choose Parameter tab 5-Click the Add Library or Object 6-Browse the location of Dev-c++ …

Before I start, I'm sure you've all seen this error, and explained how to solve it many times before, and for that I thank you for bothering to read this, and if you choose to answer, I wish to thank you in advance. So, the issue I am having is …

What is the way to convert this int to a std::string. I have searched MSDN and found that itoa could be used (vs atoi for string to int as I know how it is done). Though I cant find any good example that shows how itoa is used or if …

I am using a "GriedViewControl" with 14 columns and with this code below I can set the number "1" to the First Column and 21 Rows down. What I wonder is how I access for example [COLOR="Green"]column 3 and row 1[/COLOR] or [COLOR="green"]column 4 and row 2[/COLOR] etc... What is …

I have to write a program to read 10 integers into an array. It will then read in one more integer. My program should then compute and output how many distinct pairs of integers in the array add up to the last number that was input. Note I cannot use …

I have to write a program to read 10 integers into an array. It will then read in one more integer. My program should then compute and output how many distinct pairs of integers in the array add up to the last number that was input. Note I cannot use …

The error is: F:\C ++ Numerical Methods\Newton_Raphson.cpp(199) : fatal error C1004: unexpected end of file found [code=C++] #include <cmath> #include <iostream> using namespace std; double F ( double X ) { return pow ( X, 4) - 9*pow ( X, 3 ) - 2*pow (X, 2) + 120*X - 130; …

Hello All: How can I play a .wav file in VC#>>> Thanks in advance...

hi, Could anyone please explain to me about the following question? Although I do 'unload me', but it can't be closed immediately and some parts of that form is still processing. Eg; my project has many timers and other processing sequences. I really don't know how to solve it because …

Hi, I am a newbie when it comes to programming in xml, so my doubts can sound stupid. Anyway, here is what I want to convey. I have a test.xml file like this. [B] <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE REQUEST [ <!ENTITY cred SYSTEM "/test/credentials.xml"> ]> <REQUEST Name="calculateBusinessHours"> <start Value="06/28/2007 16:53:16" …

I have Follwing Screenshot & Code help me ? '' code for browse Button If maxrowsd2 = 0 Then Console.WriteLine(" There are No Records in the table") Exit Sub End If If incd2 <> maxrowsd2 - 1 Then incd2 = incd2 + 1 Call navigaterecord2() ElseIf incd2 = maxrowsd2 - …

Hello!! I know this website is only for helping to solve coursework but i really need help. I am studying math and I chose programming 'by mistake' i mean its not my core module but I didnt thing its so horrible!!! So I have a coursework to do and if …

This has been driving me nuts for the last half hour or so. Google didn't help. I don't know which function returns the nth character in the string. I know that it is supposed to be something like this stringname.something(n?) If someone could post the function and an example of …

Hey there; I've run into a problem! I have a program that is supposed to do multiple things. Therefore - I have a menu (switch statements). Is there any way I can make it so when 1 statement finishes, it can go back to the main menu? I can add …

hi im new to c++ and at the moment trying to write a program that generates random numbers and then sorts those numbers using bubblesort. So far ive managed to get the random numbers working but i am unable to sort the random numbers with bubblesort ? [code] #include <iostream> …

Can someone please tell me what's wrong with this? [code]my $time = "12/Jan/2008:13:38"; my ($day, $month, $year, $hour, $minute) = $time =~ /(\d+)\/(\w)\/(\d+)\:(\d+)\:(\d+)/;[/code] I've tried a hundred different things including not escaping the colons, putting parenthesis around ($time...[regex]), splitting up the assignments to $day = $1, $month = $2, etc... …

Hello all I have been wrting a blast script which results in the following error: [code] the small rnas:CAGCGATGGGGATCAAGCTC the sequnce thats being worked is CAGCGATGGGGATCAAGCTC [blastall] WARNING: Unable to open TCV-jagger.fna.nin [blastall] WARNING: : Unable to open TCV-jagger.fna.nin ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: blastall call crashed: 256 /usr/bin/blastall -p …

I have no clue why this isn't working! Basically, I've got my tree and everything working, but now I need to fit it to the input the instructor gave me. What I need to do is read the first part of a line and then input each following term into …

hi, Could anyone send me the source code to insert data into database using javabean?

This is the first time I have ever had to do a simulation type program. This is what I'm trying to do: Your application should use an array of tellers (10 tellers would be a good maximum) but on any particular run of the simulation, any number of tellers from …

I'm trying to create a function that searches through all the beds in a hotel until it finds one that is available or just ends when all the records are searched. When it finds that bed, it updates that bed record with new information (marking it as reserved or occupied). …

I am confused in tellg funtion can any body tell me its syntax also for seekg();.

Hi, I want to use linked list in the linked list. In the following code i would like to introduce new public member as species which has four to five members. How to modify the code to add new member species? In the class TREE, I would like to add …

Hello, I am having a problem for coping the string into a 2d array.. Also if the length of the string is more than 16 bytes how to continue to read till end of string.. Can anyone help.. [code=c++]int encrypt() { string text = "Encryption"; char b1[4][4]; text.length(); strcpy(text,b1); // …

I am having trouble figuring this out. I only have one error and it is in main. I am trying to write a program that will output first just a random sudoku type grid(function called random), then I am trying to output a sudoku type grid that has no duplicates …

I'm having a problem maintaining the data in the file. Everytime I enter a person's data the display code I have only displays the first one I entered. I'm not sure if there's somethin wrong with the creating or populating or just the display code I'm using [CODE=c]void addReserve() { …

1st off, Im new to C++ programming. I created a function to calculate garage parking charges. I keep getting this last error: HourFee.cpp(65) : error C2065: 'ROW_SIZE' : undeclared identifier this is my error ---> ***int vehicleInfo[ROW_SIZE][COLUMN_SIZE];*** [code=cpp]void calculateCharges() { int x; int r; for (x=1; x<=10; x++) const int …

Hi i have my code that finds every instance of my search criteria in a text file and tells me the position in the text file it is located at. The next step i want to do is stream the bytes that follow each instance of my search criteria into …

Could you have me please?I have made a web browser in visual basic 6.0 and its working well for the most part. I have a several questions. Basing most of my project off of IE7, How do i get my web browser to show the "view source" function of webpage? …

Hi guys, I have an input file as below (it is a family tree): 1 0 0 2 0 0 3 0 0 4 1 2 5 1 2 6 0 0 7 3 4 8 5 6 9 7 8 10 7 8 where column 1 = individual number …

Hello, I'm new to programming and I have a simple project to plot a graph using gwin. The graph should just be a series of circles curving upwards on the y axis, the amount of plots should be defined by the user. I think I have everything almost correct but …

SO here it is; start with an array that couts random numbers I used the generate function now check those numbers if they repeat so return true if false is returned then you can go onto the next random_integer to check..here I use the contains function the problem is generate …

Hey guys, new poster here. I'm rather desperate here, I just do not understand the concept of templates very well. I've used the search function, but I don't see the problem addressed in any other threads. Any help is much appreciated. My assignment is to create a templated vector class …

Hello, I'm a super newbie at VB and I'm trying to write a very simple math program. The program is supposed to do some arithmetic and display the results, piece of cake. The problem lies in displaying the results. I have no clue how to do it. I went surfing …

Hi all, I have a problem with Java GUI. How can I set a certain component to be in front of another component or behind it?! i.e. Is there a way to: SendToBack & SendToFront in java?

I need help Fixing this I traced through the code, and it compiles not error but when I run the program its just goes crazy I need help finding a the soultion to this problem please Thank you very much [CODE]#include <iostream> #include <fstream> #include <cstdlib> using namespace std; int …