199,114 Archived Topics
Remove Filter  | |
 | Suppose that I have a program named myprog, and I type this in a shell [code] $ myprog -z hello -m "this is a message" [/code] The function main in myprog will receive a char** argv containing the following strings [code] "-z", "hello", "-m", "this is a message" [/code] So … |
| | Hi All, I have written a small interactive console application to help me understand variables, when you run the application it will ask you for a length and a width and it is supposed to work out the area. It works up to the part were it is supposed to … |
| | hello everybody, this is my first post in this forum and i hope to find help. i'm beginner in c# and i search for simple tutorials in databases access in c#. |
| | Hi, I hav heard that it isn't that simple to write a program in linux using c. Lots of commands n stuff.Please simplify what actually I've got to do to run turbo c++ in my linux laptop as I am a beginner.  |
| | hi guys ,im trying to send serialized php object to c++ server. i dont have clear idea if it is possible to deserialize the php object in c++ code.i dont know how to convert it into c++ object and get the value out of it. when im running the server … |
| | Hi, attached in the attachment below has a screenshot of what I am trying to accomplish... I have hurdle marks for individual students and i am trying to compute the total of those marks. How can I access those values, compute the total, and store them back in the "Total … |
 | Hello everyone, I would like to write an application that would allow me to change the functions of the usually-useless F keys (especially F8, I hate that one) into functions that I specify in code. I would like to let some of them open certain files, or paste text.. etc … |
| | I am a student really struggling with Java and needless to say, I am pretty isolated from anyone who gives a care enough to help me, I am on my 8th week and really struggling with GUI's I have some code written, but the gui will not display, I am … |
| | Just like the title says. I need help on clicking on a box in a grid and filling it in with a color. Right now each block is 10x10 so I would have to use a 9x9 rectangle so it doesn't overlap. [CODE] #!/usr/bin/python import pygame,os,sys from pygame.locals import * …  |
| | i have this apache-php server runing with some php and mysql apps.. I also have this application that uses java and one module is running through RMI, and its automatically started by the init.d using a shell script... then it's visible through a port (which is configured on the module … |
| | I want to create a string like this: (just theoretically:-)) [CODE]import random list1 = ["1", "2", "3"] string1 = random.choice(list1) string2 = "Random Number is" + string1 [/CODE] but I want string2 to show up formatted like this: Random Number is [INDENT] 2[/INDENT] But, for the life of me I … |
| | I have written this piece of code which removes spaces in string,its working perfectly, but the other thng that I need is to pass string to left trim function and remove spaces, the new string should returned to the main program, the new string should be passed to the right … |
| | Here the my code( Im new to DOT NET) Im using some socket.connection with port 25. private readonly byte[] _buffer = new byte[1024]; int structId = BitConverter.ToInt32(_buffer, 0); Type currentStructType; if (!Structs.TryGetValue(structId, out currentStructType)) throw new BufferParserException(string.Format("Structure with ID = {0} is not supported.", structId)); here Im getting structId= 540029490 …  |
| | I'm selecting value from my database, passing it to datatable then giving DataGridView.DataSource value of datatable. The thing is that in those rows i'm also selecting some dates and problem is that my default date in database is '1900-01-01 00:00:00' because i use "smalldatetime". And what i want is this...when … |
| | Hello.. Can someone help me with this tutorial. only have a background of how to creat a dynamic array in 4 steps but not other than that. And the question seems complicated more than only that. So kindly please someone help me and wxplain it to me. --------------------- write a … |
| | I am finishing up writing an extensive C/C++ program and am in dire need of completing these 4 short JAVA programs. Any help would be appreciated GREATLY! (I missed a few days of lecture and am extremely behind in this class.. :sad: EDIT: actually just helping me with one or …  |
| | Hallo everyone im starting to learn perl and i have a problem , i have an exercise asking me to count all the letters each apart in a DNA string , for example my @DNA =( ctagctagcatgacgatacatgacagataggatacagatagacagatacagatacagatacagatagacccatgacagatac) so i have to make a perl script showing the user how many … |
| | [B]Hi Friends Is There Any Way To Open And ReEdit An .exe File... Suppose I Have a Portable .exe File Which Needs No Installation in My Windows. And I Want To Edit Some Icons or Some Text which is Given in The .exe File So What Should I Need To …  |
| | Cheers guys, my first post here. I've been reading a lot but i can't seem to find any scenario that helps me out with my problem. I'm trying to take input from a file in the form of some shape... rectangle/square, and store it somehow. The shape is composed of … |
| | hello frndz.. i really need some urgent help on a simple problem. im storing a string in a database, say its "1 2 3",these are actually the id's of something. in order to get the name from the ID, i need to seperate the id's from the string, that is … |
| | I'm new in programming and need to validate this class email. Anybody can help? public class Email { private String email; public Email() { email = ""; } public Email(String emailAddress) { this.email = emailAddress; } public String getEmail() { return email; } public void setEmail(String email) { this.email = … |
| | Hi , I'm getting the below error when i'm trying to create a excel boject in my ASP page. Please help me. Error Type: Server object, ASP 0178 (0x80070005) The call to Server.CreateObject failed while checking permissions. Access is denied to this object. |
| | I am very poor in calculating complexities. Please some one let me know what is the complexity of the below program. I actually want to write a program for finding the nth last element with 0(n) complexity. but unable write, please give me some idea. the below code works perfectly … |
| | N00B. If I compile a simple Hello World! program on a 64bit linux, will it work on a 32bit linux? (I'm using gcc). [CODE]#include <stdio.h> int main(void) { printf("Hello World!"); return 0; }[/CODE] |
| | Hi, I m working on a project in which i need to pop up a window when a certain condition matches. for example i fix up an appointment at 2.30 pm for a caller.when the time becomes 2.20 i wil pop up the window to alert the user that he … |
| | I am having a small problem... I can connect to a local MySql Database using: [CODE]SQLConn.ConnectionString = "Data Source=servername;" & _ "Initial Catalog=databasename;" & _ "User ID=username;" & _ "Password=userpassword;" [/CODE] Where servername is "localhost". I need to make a connection to an online database (same data structure). What should … |
| | Hi, I am doing a student progression system where the application is able to keep track of student marks. I have a problem currently and I've been spending nights on this. Let me briefly explain. Marks are calculated based on their hurdles. So for instance, H1 = xx%, H2 = … |
| | How to: 1. Buffer output ? 2. Get its size ? 3. Print the buffer ? [CODE]#include <stdio.h> int main(void) { printf("Tons of printf lines\n"); // 1. Somehow buffer the output up until this point printf("The size of the buffer is: %i\n", SIZEOFBUFFER); // 2. Get and print the size … |
| | I have a blog with multiple pictures per post, I would like each picture to be rated independently by the public with a star rating system. Thus far I have not been able to find a script that has the appropriate information for implementation along with the script, just a … |
| | I don't know how to write marquee with links in java application.If someone knows, pls help me. |
| | I am receiving MySQL error 1265 when I try to insert records into a table and after googling this error I am no closer to understanding the problem. Here is the error message that is returned: Warning Code : 1265 Data truncated for column 'DATE_FIELD' at row 1 Here is … |
| | Hi I have a class MapMaker [CODE] class MapMaker { private: Node *grid[MAP_WIDTH][MAP_HEIGHT]; public: MapMaker(); ~MapMaker(); /*this does not work*/ Node*** getMap(int i); }; [/CODE] I need a function that returns the "grid" attribute but I do not know how. Please help me. Below is the code that implements the …  |
| | I'm having a problem implementing the complexdivbyzero exception handler. It is supposed to be triggered if the user inputs a complex number with both the real and imaginary part being zero. Any help would be appreciated. [CODE]class ComplexDivByZero{};[/CODE] [CODE]complexType complexType::operator/ (const complexType& otherComplex) const throw (ComplexDivByZero) { complexType temp; if … |
| | i m final year student of computer engineering and there is problem for me in my final year project. i want to attach databases to sql server dbms from one of the form of my vb.net application. the idea is that a want to have a button name "Browse" when … |
| | oldAccount text file is Nicholas, Diana, Eric,Andy, Alex , AMy CurrentAccount text file is Andy Alex Amy Kelvin cherry Betty import java.util.*; import java.io.*; public class Example2 { public static void main(String[]args) throws IOException { System.out.print (" Old Account is: "); System.out.println(); TreeSet<String> oldAcc = new TreeSet<String>(); Scanner oldacc = … |
| | Hi there, I am new in java and some basic help would be appreciated. e.g 1-What's the out put of; double number = (1/3)*3; System.out.println("(1/3)*3 is equal to " + number); What's missing? 2- Convert each of the following mathematical formula to java expression; 3x and 3x+y Thank you in … |
| | need to decode and encode the following text=== {Newton’s Law of Software Engineering Law 1: Every Software Engineer continues her/his state of chatting or forwarding mails unless s/he is assigned work by external unbalanced manager. Law 2: The rate of change in the software is directly proportional to the payment … |
| | hey every one i'm new here i have visit this forum many times but today i just register i have a big big problem >__< i try to solve it but i can't its about the The Predicate Calculus this is its rule Every atomic sentence is a sentence If … |
| | Hello, I am trying to make a GPA calculator, the code below works fine and the output is also fine the only problem is if the GPA is 4.0 or 3.0 or 2.0 or 1.0 it gives me output as 4, 3, 2, 1 i had used variable as float … |
| | I have little upload script and i wonder how to rename a file if the file with same name already exists.  |
| | hi, i want to write code on validation of text box , combo box for make them not null fields, And other for mae a text box only accept integer , one only accept string not integer value. so pls. tell me where shud i write dis code & give … |
| | hello i'm subhash n m persuing BCA IInd year n got an assignment of writing a program to create a binary tree n display the elements level wise ie i need to display in a form of tree. for example if elements are 6,4,8,3,5,7,9 then i need to display it …  |
| | Hi there, Trying to write a small script in python. What it will basically do is this; 1- A SSH user initiates the python script (from SSH remotely) 2- The script gets the connected users IP (the user is connected through SSH) 3- The connected IP is sent back to … |
| | I am currently working on a php site that pulls in data from a MySql server, Unfortunately the code I'm using to run the query to get the data from the server is causing a nasty parse error on my site, and I am having extreme dificulty sorting it out. … |
| | This code is just handling the SIGCHLD signal, but as you can see, the parent process should ignore this SIGCHLD signal according to the signal function. But in fact, the parent process will omit the signal function, and handling the child process using "wait". I wonder why the parent do … |
| | I just keep getting the same error. can not insert record. Problem near keyword "where". [CODE]Imports System.Security Imports System.Data.SqlClient Imports System.Web.Configuration Imports System.Data Partial Class admin Inherits System.Web.UI.Page Public connectPath As String = ConfigurationSettings.AppSettings("Maya") Protected Sub fillDropList(ByVal sender As Object, ByVal e As System.EventArgs) Handles Me.Load If Not Page.IsPostBack Then … |
| | hii everyone... i am working on a webpage as my class assgnmnt nd using php-mysql for that.. plz guide me how this thing can be done?? i want to add some thing in a table and if there is a table of same fields(columns) that i want then add in … |
| | In the view below, I need the line "[COLOR="Red"]isnull(wwr.packed_qty, isnull((select sum(qty_on_hand) from lot_loc where item = coi.item and loc like 'P%'), 0)) packed_qty,[/COLOR] " to include a "[COLOR="red"]or 'S%[/COLOR]'", so that both P and S are found, but I get a syntax error when I add it. What is the …  |
| | [code]<?php $tags = get_meta_tags('http://www.realgm.com/'); echo $tags['keywords']; echo $tags['description']; ?> [/code] i just used any website.. i can't get the meta tags though... what am i doing wrong? i get these error messages.. Warning: get_meta_tags() [function.get-meta-tags]: URL file-access is disabled in the server configuration in /home/ustackc1/public_html/menu.php on line 78 Warning: get_meta_tags([url]http://www.realgm.com/[/url]) … |
| | it seem my connection string doesnt work? [code]$connect = mssql_connect("192.170.10.798","sa","gasd") or die(mssql_error()); $test = mssql_select_db("banex", $connect) or die (mssql_error()); [/code] whats wrong with my connection string? |
The End.