I am really trying to pass this class, and am simply struggling majorly with C, I need help with these 3 problems that are due today by midnight, please help, will appreciate it greatly, and even pay if thats what it takes. I did problem 1, but used math.h, which i just found out gives me a 0 in the homework.
http://ece15.ucsd.edu/Labs/lab3.pdf
Website is much better !
This lab relates to the material covered in Lecture Units 6 and 7 in class, and in Chapters 4 and 5 of the
Kernighan & Ritchie textbook. Here are several instruction specific to this lab:
In Problems 1 and 3, you will be reading input from a file; use the fscanf() function to do
so. When reading input from a file, you do not need to verify its validity. You can assume
that it has the expected type and the expected value(s). In Problem2, you will be reading input
from stdin; input verification requirements for Problem2 are described therein.
In each of the three problems in this lab, you will be required to declare and define certain
functions. Doing so is essential: code that compiles and runs correctly, but does not implement
all the required functions will not receive full credit. You are also welcome to implement
additional functions. While this is not required, it can make your code easier to write.
Throughout this lab, you should not use any functions from the C standard library, except for
those functions that are declared in the file <stdio.h>, such as printf (or fprintf),
scanf (or fscanf), fopen, fclose, etc. In Problem2, you can also use the functions
rand and srand declared in <stdlib.h> and the function time declared in <time.h>
Using other library functions in Problems 2 and 3 may result in partial credit. However, if you
use any function from <math.h> in Problem1, you will receive 0 points for this problem.
For each of the three programs below, you should use the file templateF.c provided
on the course website at http://ece15.ucsd.edu/Main/Homeworks.html. Note
that this file differs from the file template.c used in all the previous labs.
Try to make your programs easy to follow and understand: choose meaningful names for
identifiers, use proper indentation, and provide comments wherever they are useful. While
this is not required, it could help you receive partial credit: programs that are not correct and
are also difficult to understand will receive zero credit, even if they are partially correct.
This lab will be graded out of 100 points. Problems 1 and 3 are worth 30 points each, while Problem2
is worth 40 points. You should submit the lab by following the instructions posted on the course website
at http://ece15.ucsd.edu/Labs/TurnIn3.html.
Problem1.
Write a C program, called cos approx.c, that computes the approximate value of cos(x) according
to its Taylor series expansion:
cos(x) =
1å
n=0
(−1)nx2n
(2n)!
= 1 −
x2
2!
+
x4
4!
−
x6
6!
+
x8
8!
−
x10
10!
+ · · · (1)
This series produces the exact value of cos(x) for any real number x, but contains an infinite number of
terms. Obviously, a computer program can compute only a finite number of terms. Thus, you will have
to truncate the infinite series in (1). Your program should be able to do so in two different ways.
Fixed number of terms: Implement the function cos N(double x, int N) that accepts as parameters
a real number x and an integer N (you can assume that N will be always positive). The
function cos N should return the sum of the first N terms in (1), as a double.
Fixed precision: Implement the function cos delta(double x, double delta) that accepts
as parameters a real number x and another real number (you can assume that will be
always positive). The function cos delta should return, as a double, the sum of the first N
terms in (1), where N is the smallest positive integer such that
N−1
å
n=0
(−1)nx2n
(2n)!
−
N−2
å
n=0
(−1)nx2n
(2n)!
< (2)
Notice that the first sum in (2) contains N terms, while the second sum contains N −1 terms. It is
possible for the second sum in (2) to be empty—this happens when N = 1. You should assume
that an empty sum evaluates to zero.
Your program should read its input from a file called cos input.dat. The first line in this file is
a positive integer m (you can assume that m 6 64). The first line is followed by m other lines; each such
line constitutes a test case. Every test-case line contains three numbers separated by whitespace. The
first number is either 1 or 2, indicating whether you should use cos N or cos delta. The second
number is the value of x for which you should compute cos(x). The third number y is either the required
precision (if the first number is 2) or the required number of terms N (if the first number is 1).
In the former case, y will be a floating-point number while in the latter case, it will be an integer. In
both cases, you can assume that y is positive. Here is a sample cos input.dat file:
51
-1.00 6
2 1 0.00001
1 1.5 2
2 2 0.09
2 2 1.1
The program should write its output to the file cos output.dat. The output file should consist of m
lines, one per test case. For each test case, the program should print the test-case number followed by
cos(x.xxx) = y.yyyyyyyyyyyy. In the above, the argument of cos(·) should be printed with 3 digits
of precision, while its (approximate) value should be printed with 12 digits of precision. For example,
here is the file cos output.dat that results upon processing the file cos input.dat above:
Case 1: cos(-1.000) = 0.540302303792
Case 2: cos(1.000) = 0.540302303792
Case 3: cos(1.500) = -0.125000000000
Case 4: cos(2.000) = -0.422222222222
Case 5: cos(2.000) = 1.000000000000
Notes:
◮ As part of the solution, you are required to declare, define, and call the following two functions.
The function factorial(int n) that accepts as a parameter an integer n > 0 and then returns
n! as an int. Recall that n! = 1·2·3· · ·(n−1)·n for n > 1, while 0! = 1. The function
power(double x, int n) that accepts as parameter a real number x and an integer n > 0
and returns xn as a double. Recall that x0 = 1 for any real number x.
2
◮ You do not need to worry about numerical overflows. You can assume that the input is such that
they do not occur. For example, in the function factorial(int n), you can assume that the
parameter n is small enough so that n! fits in a variable of type int. For most machines, this
means that n 6 12. Optional, not for credit: How would you modify this function so that it
can compute n! for much larger values of n?
◮ You are not allowed to use any functions declared in <math.h> in the file cos approx.c that
you submit. However, it might be advisable to use standard-library functions such as pow(x,y)
and cos(x) during the development and debugging of the program, in order to compare their
output with the output of the functions that you implement. If you choose to do so, do not forget
to delete the relevant parts of the code in the final version of cos approx.c that you submit.
Problem2.
The famousMatch&Hit game is played by a computer and a human player as follows. First, the computer
selects a random 4-digit number N = a·103 +b·102 +c·10+d, where a, b, c, d are distinct nonzero
digits— that is, a, b, c, d are distinct elements of the set {1, 2, 3, 4, 5, 6, 7, 8, 9}. Let us call numbers
like this valid. The human player then tries to deduce N from a sequence of queries to the computer.
Each query consists of a valid 4-digit number M = x·103 + y·102 + z·10 + w. The computer
responds to each query with the number of matches and the number of hits. A match is a digit of N that
appears in M at the same position (thus each of x = a, y = b, z = c, or w = d counts as one match).
A hit is a digit of N that appears in M, but not at the same position. For example, if N = 5167, then
the queries 2934, 1687, 7165, 5167 will result in the following numbers of matches and hits:
5167
2934 −→ no matches and no hits
1687 −→ one match and two hits
◦◦ •
7165 −→ two matches and two hits
◦••◦
5167 −→ four matches and no hits
••••
where matches are denoted by • and hits are denoted by ◦. The play continues until the human player
either wins or loses the game, as follows:
Human player wins if he submits a query with 4 matches (that is, M = N).
Human player loses if he submits 12 queries, none of them with 4 matches.
Write a C program, called match and hit.c, that implements (the computer part of) theMatch&Hit
game. In this program, you are required to declare, define, and call the following functions:
◮ The function isvalid(int n) that accepts as a parameter an arbitrary integer. The function
should return 1 if the integer is valid, and 0 otherwise. Recall that an integer is valid if it is positive,
consists of exactly 4 decimal digits, and all these digits are nonzero and distinct.
◮ The function choose N(void) that returns, as an int, a uniformly random choice of a valid
integer N. The function should call both the rand library function and the function isvalid.
It should keep calling rand until the number generated thereby is valid. Recall that before the
function rand is invoked, the random seed should be initialized using srand(time(0)).
3
◮ The function matches(int N, int M) that accepts as parameters two integers N and M
and returns, as an int, the number of matches. You can assume than both N and M are valid.
◮ The function hits(int N, int M) that accepts as parameters two integers N and M, then
returns, as an int, the number of hits. You can assume than both N and M are valid.
Here is a sample run of this program, assuming that the executable file is called match and hit.
This run illustrates a situation where the human player wins the game. User input is underlined.
/home/userXYZ/ECE15/Lab3> match and hit
***Welcome to the MATCH and HIT game***
The computer has selected a 4-digit number.
Try to deduce it in 12 rounds of queries.
Round #1
Please enter your query (4 digits): 5341
-> 2 matches and 1 hit
Round #2
Please enter your query (4 digits): 1235
-> 1 match and 2 hits
Round #3
Please enter your query (4 digits): 2345
-> 4 matches and 0 hits
**********************************
CONGRATULATIONS! You won the game!
**********************************
Notice that a singular form (match, hit) is used with the number 1. You can easily achieve this functionality
with the ? : conditional expression, as shown in class. The next sample run illustrates a situation
where the human player loses the game. Again, user input is underlined.
/home/userXYZ/ECE15/Lab3> match and hit
***Welcome to the MATCH and HIT game***
The computer has selected a 4-digit number.
Try to deduce it in 12 rounds of queries.
Round #1
Please enter your query (4 digits): 1234
-> 0 matches and 3 hits
...
... Round #12
Please enter your query (4 digits): 2435
-> 2 matches and 2 hits
*********************************
Sorry, out of queries. Game over!
*********************************
4
Notes:
◮ If the user enters a non-integer, print themessage “Invalid query. Please try again!”
Notice that if the user enters an integer followed by noninteger characters, these characters should
be simply ignored (check the value returned by the scanf function). If the user enters an integer
that is not valid, print the message “Invalid number. Please try again!” In both of
these cases, you should then prompt the user to enter another query, and keep doing so until the
user provides a valid input. The following sample run illustrates all this.
/home/userXYZ/ECE15/Lab3> match and hit
***Welcome to the MATCH and HIT game***
The computer has selected a 4-digit number.
Try to deduce it in 12 rounds of queries.
Round #1
Please enter your query (4 digits): ##
Invalid query. Please try again!
Please enter your query (4 digits): 0##
Invalid number. Please try again!
Please enter your query (4 digits): -5341
Invalid number. Please try again!
Please enter your query (4 digits): 123456789
Invalid number. Please try again!
Please enter your query (4 digits): 5340
Invalid number. Please try again!
Please enter your query (4 digits): 5344
Invalid number. Please try again!
Please enter your query (4 digits): 5341#OK?
-> 2 matches and 1 hit
Round #2
Please enter your query (4 digits): 1235
-> 1 match and 2 hits
Round #3
Please enter your query (4 digits): 2345
-> 4 matches and 0 hits
**********************************
CONGRATULATIONS! You won the game!
**********************************
◮ The maximum number of queries (which we have, so far, assumed to be 12) should be introduced
as a symbolic constant MAX QUERIES in the beginning of the program, using the #define
compiler directive. The number of digits in a valid integer (which we have, so far, assumed to
be 4) should be also introduced as a symbolic constant called N DIGITS. You can assume that
N DIGITS is one of 1, 2, 3, 4 and MAX QUERIES is an integer in the range 1, 2, . . . , 24. The
program should keep working correctly for all such values of N DIGITS and MAX QUERIES.
◮ You can always win the game with at most 12 queries, if you query cleverly. Try it, it’s fun! Can
you guarantee a win with less than 12 queries? If so, what is the minimum number of queries
you need? You do not need to answer these questions, but you are welcome to consider them.
5
Problem3.
The deoxyribonucleic acid (DNA) is a molecule that contains the genetic instructions required for the
development and functioning of all known living organisms. The basic double-helix structure of the
DNA was co-discovered by Prof. Francis Crick, a long-time faculty member at UCSD.
The DNAmolecule consists of a long sequence of four nucleotide bases: adenine (A), cytosine (C), guanine
(G) and thymine (T). Since this molecule contains all the genetic information of a living organism,
geneticists are interested in understanding the roles of the variuos DNA sequence patterns that are continuously
being discovered worldwide. One of the most common methods to identify the role of a DNA
sequence is to compare it with other DNA sequences, whose functionality is already known. The more
similar such DNA sequences are, the more likely it is that they will function similarly.
Your task is to write a C program, called dna.c, that reads three DNA sequences from a file called
dna input.dat and prints the results of a comparison between each pair of sequences to the file
dna output.dat. The input file dna input.dat consists of three lines. Each line is a single sequence
of characters from the set {A, C, G, T}, that appear without spaces in some order, terminated by
the end of line character \n. You can assume that the three lines contain the same number of characters,
and that this number is at most 241 (including the character \n). Here is a sample input file:
ACGTTTTAAGGGCTGAGCTAGTCAGTTCATCGCGCGCGTATATCCTCGATCGATCATTCT
CTCTAGACGTTTTAAGGGCTGAGCTAGTCAGTTC
ACGTTTTAAGGGCTTAGAGCTTATGCTAATCGCGCGCGTATATCCTCGATCGATCATTCT
CTCTAGACGTTTTAAGGGCTAAGGCGCGTAATTA
TCGTTTGAAGGGCTTAGTTAGTTAGTTCATCGGCGGCGTATATCCTCGATCGATCATTCT
CTCTAGACGTTTTAAGGGCTGAGCCGGTCAGTTA
Each of the three lines (shown with wrap-around above) consists of 95 characters: the 94 letters from
{A, C, G, T} and the character \n (not shown). The output file dna output.dat must be structured
as follows. For each pair of sequences #i and #j, with i, j ∈ {1, 2, 3} and i > j, you should print:
• A single line, saying “Comparison between sequence #i and sequence #j:”
• The entire sequence #i in the first row, and the entire sequence #j in the third row.
• The comparison between the two sequences in the second (middle) row. This should be printed as
follows. For each position, if the two bases are the same in both sequences then the corresponding
base letter (one of A, C, G, T) should be printed; otherwise a blank " " should be printed.
• A single line, saying “The overlap percentage is x%”where x is a floating-point number
whichmeasures the percentage of letters thatmatch in the two sequences. This number should
be printed with a single digit of precision after the decimal point.
Each line in the output file dna output.dat should contain at most 61 characters, including the end
of line character \n. If the DNA sequences are longer than that, then each of the three rows mentioned
6
above should be split across several lines, with the first few lines containing exactly 60 letters, and the
last containing the rest of the letters. Here is a sample file dna output.dat which results upon
processing the file dna input.dat above:
Comparison between sequence #1 and sequence #2:
ACGTTTTAAGGGCTGAGCTAGTCAGTTCATCGCGCGCGTATATCCTCGATCGATCATTCT
ACGTTTTAAGGGCT AG T G T ATCGCGCGCGTATATCCTCGATCGATCATTCT
ACGTTTTAAGGGCTTAGAGCTTATGCTAATCGCGCGCGTATATCCTCGATCGATCATTCT
CTCTAGACGTTTTAAGGGCTGAGCTAGTCAGTTC
CTCTAGACGTTTTAAGGGCT AG A TT
CTCTAGACGTTTTAAGGGCTAAGGCGCGTAATTA
The overlap percentage is 80.9%
Comparison between sequence #1 and sequence #3:
ACGTTTTAAGGGCTGAGCTAGTCAGTTCATCGCGCGCGTATATCCTCGATCGATCATTCT
CGTTT AAGGGCT AG TAGT AGTTCATCG GCGTATATCCTCGATCGATCATTCT
TCGTTTGAAGGGCTTAGTTAGTTAGTTCATCGGCGGCGTATATCCTCGATCGATCATTCT
CTCTAGACGTTTTAAGGGCTGAGCTAGTCAGTTC
CTCTAGACGTTTTAAGGGCTGAGC GTCAGTT
CTCTAGACGTTTTAAGGGCTGAGCCGGTCAGTTA
The overlap percentage is 88.3%
Comparison between sequence #2 and sequence #3:
ACGTTTTAAGGGCTTAGAGCTTATGCTAATCGCGCGCGTATATCCTCGATCGATCATTCT
CGTTT AAGGGCTTAG T G T ATCG GCGTATATCCTCGATCGATCATTCT
TCGTTTGAAGGGCTTAGTTAGTTAGTTCATCGGCGGCGTATATCCTCGATCGATCATTCT
CTCTAGACGTTTTAAGGGCTAAGGCGCGTAATTA
CTCTAGACGTTTTAAGGGCT AG CG A TTA
CTCTAGACGTTTTAAGGGCTGAGCCGGTCAGTTA
The overlap percentage is 79.8%
Notes:
◮ As part of the solution, you are required to declare, define, and call the following functions. In
these functions, you can assume that input and output are global variables of type FILE *.
• The function read DNA(charsequence[]) that reads a DNA sequence from input,
stores it in the array sequence[], and returns the number of letters read, as an int.
• The function compare DNA(char seq1[], char seq2[], char seq3[], int n)
that stores in the array seq3[] the comparison sequence of the two DNA sequences stored
in seq1[] and seq2[]. The length of these DNA sequences is assumed to be n. The function
returns, as a double, the percentage of overlap between the two DNA sequences.
• The function print DNA(char seq1[], char seq2[], char seq3[], int n)
that prints to output the DNA sequences stored in seq1[] and seq2[], as well as their
comparison sequence stored in seq3[], according to the rules explained above. The length
of all these sequences is assumed to be n. The function does not return a value.
◮ The numbers 241 and 60, used above, should be defined as symbolic constants MAX IN LENGTH
and OUT LENGTH, using the #define compiler directive. The program should keep working
correctly if the values of these symbolic constants are changed (within a reasonable range).
7
