[user-interface:gui] Forum Topics

Hi i need an event handler method to let an user use the 4 arrow keys (up,down,left,right) from a keyboard input ... and also the letters "Y" for yes and "N" for no on the keyboard. [code]import java.io.IOException; import java.util.logging.Level; import java.util.logging.Logger; //group Albers, Rodriguez, Gonzalez, Leys, Larson, and Aponte …

I'm currently working on a small text game project as an exercise in Java. Just recently, I've come to a point where I am having difficulty with the logic behind the flow of the program. It had started out as a console application with a very sequential series of events …

Hello, all. After trying to wade through a great deal of undocumented and uncommented code in order to speed up a frame capture rate, I've decided that, for my sanity and that of my boss and any coders to follow me, I should start over and write it myself. I …

I'm new to here.so i posted it on the code thread pls go through it and help me [url]http://www.daniweb.com/code/snippet271890.html[/url]

[code]#Blast workbench using biopython from Bio.Blast import NCBIWWW ##result_handle = NCBIWWW.qblast("blastn", "nr", "8332116") fasta_string = "AATTCAGTGGCAAAAAAAAAACTCAAATTTTAGGGAAGGCCCTAATATTATCAAATAATTAGAGGGGGGG" result_handle = NCBIWWW.qblast("blastn", "nt", fasta_string) save_file = open("my_blast.xml", "w") save_file.write(result_handle.read()) save_file.close() result_handle.close() result_handle = open("my_blast.xml") from Bio.Blast import NCBIXML for record in NCBIXML.parse(open("my_blast.xml")) : #We want to ignore any queries with no search results: …

The application will ask questions like: What comes after D? A child is expected to answer the question and the application will inform the child if the answer is correct or wrong. The application will ask a total of 20 questions. After all 20 questions have been answered, the application …

here i attached my question ... and i have done the first part and i stuck in the logic part ,can anybody help

This program is a GUI shopping menu with text fileds next to item descriptions. My question is about the add method in ShippingCart class. It is called every time an action occurse in a text field, from a GUI class not shown here, where quantity requests are entered. So when …

I'm a bio informatics student who is leaning programming.With the help of this site and other blogs I made this one so far.I need to create a interface which give a text box to enter sequence and a start button and a window that display results.I went through Wx tutorials …

Hello, i need assistance with a mortgage calculator program. the requirements are : Program designed with GUI to Write the program in Java (with a graphical user interface) and have it calculate then display the mortgage payment amount from user input of the amount of the mortgage and the user's …

I was wondering if anyone knew of a good library to use for making gui's in c++. You should know that i know of winprog but the problem is that its c. I don't want c because i haven't learned c. I would like to use something that you code …

Hi, I have serial data that can come in at irregular intervals from a hand held barcode scanner. The scanner continuously looks for a barcode (no button or trigger is ever pressed) and when the scanner captures a valid barcode it sends the code to the PC over serial. What …

hiii....i done some graphics programming on a turbo c compiler & i would like to link it to a front end...& may be even develop a gui out of it....please tell me the procedure to link a turbo c code to a front end

Just to check with u guys I got a GUI Menu with few selections e.g. "Monkey" , "Elephant", "ViewList", "Exit" . When i click on "Monkey" a JOptionPane Sub-Menu will pop up and i could add or sell . but when i want to go back to the Gui Menu …

Hello! I am in the 11th grade and I have started with one of my colleagues to work on a file compression program based on Huffman coding. I have previously worked with python (a program that handles some .xls files) but this project is more complicated so I shall need …

Hi all, i am not an experienced Java GUI programmer and its the first time i'm asking for help in programming on a forum. I have this simple GUI which allows people to mark text with different categories. I use JTextPane and DefaultStyledDocument. Basically, i took most of the code …

i want to develop a c++ program that may take a visual input like a graph and then manipulate it to find whether its a planar graph or not....i am well versed with the algorithm to do this...just want to know that how can I read the input from a …

Hi i was wondering if it was possible, in java, to save a session/state of an application and then reloading the data (all automatically)when re-opening?? I have a GUI with some textarea, a jtree with filesystem hierarchy and a jpanel with buttons. I can create many buttons and within these …

I did a project last year in VB for image processing, basically link to a folder, load an overlay and loop through the folder overlaying a watermark. I now need to get the same thing running in python to cater for cross platform use. I have translated all the image …

Hey, I'm having problems with JTextPane, I have class which has gui and other class for the software logic (in this case text editor), so when I try to save a file using filechooser it works fine to the point where it needs to save the information from the JTextPane, …

Hello guys... I'm trying to develop an application with a GUI that sends and receives data via http, by sending a url via POST and eading the content generated by the url. or instance, if i send a nick and order number, the server generates a SessionID via html. My …

I was searching around but I could not find it: I'd like a tool(free or paid) that is able to manage multiple MySql servers from the same GUI. I know about a few thick-client apps that do this, but I need one that you can use it from internet(forget about …

I've created a simple GUI that's purpose is to square or cube a given number that the user enters into the textfield. This all works fine but what I now want to do is to fine-tune it by testing the input. For example if the user enters a non-numerical value …

I was searching around but I could not find it: I'd like a tool(free or paid) that is able to manage multiple MySql servers from the same GUI. I know about few thick-client apps that do this, but I need one that you can use it from internet. So far …

Hi i wrote the following script in winrunner to check the boundary range: [B]1. VB Program contains (text box,Calculate and clear button) Calculate button Coding:[/B] [CODE] Dim a As Integer a = Val(Text1.Text) If (a > 100) Then MsgBox ("value exceeds the maximum range") ElseIf (a < 50) Then MsgBox …

Hi, first time poster here, but i'm having some troubles with a project i'm working on. I'm not in need of a solution, just some pointers to get me going? I have a GUI which is a text editor for a programming language. Basically, i have all the functionalities of …

I have a JFrame with 2 Password Fields and 3 buttons, the following code was provided to me as a part of the actual GUI builder, but it places the focus on the second field rather than the first one. [CODE] frame.addWindowListener(new WindowAdapter() { public void windowActivated(WindowEvent e) { newContentPane.resetFocus(); …

Hi, im trying to use an actionlistener attached to a button to add a component to a frame I have created. The actual button should add to the frame a circle with some text placed in it which I have already created, it works fine so there's no problems there. …

So i ve managed to create different shapes in my GUI window. But how would i go about deleting a certain shape or line from the window when I press delete on my GUI screen?

I am writing a flat-file database app using SQLite. That part works just fine, but the GUI not so much. The issues are arising in the bindings. I have a list of accounts displayed in a datagrid. The datagrid has its ItemsSource set to a List<Accounts> collection. That works fine. …

Each time I create a new GUI, the bit that I always hate, is the bit where the buttons and entries look like I am working on a Windows 98 machine, isn't there a way to make my buttons and entries look like Qt would look like? They're well squary …

Hi all. I am up to the final stage of my system, and it requires use of the observer/observable pattern, something I haven't a clue about! Basically, I now have a functioning "WatchList" system with which to store specific objects (Locations). Now, these objects have a number of fields relating …

Hi @ all, b4 things get serious. :icon_smile: Im using MFC with VCPP 6. I have a simple dialoge based app. Im using a triggered event with which I want to update the content of a CEdit box. The ASSERT of IsWindow fails because m_hWind = 0, I figure this …

hi all, actually i have made a gui in my application..there is a button in it. i want that when the button is clicked,a file should open up and i can see through its contents..how will that be done...please give ideas..thanks in advance..:)

How to add a custom button in Non Client Area of Dialog near Minimize and Maximize button.

Hi, im trying to call this method in my class "MyWidget" which is suppose to draw a line when someone indicates the coordinates via 4 parameters. Here is the method: [CODE]public void Connect(int xline, int yline, int nextX, int nextY) { Graphics g = getGraphics(); g.drawLine(xline, yline, nextX, nextY); } …

Hello. First of all I'd like to say HI to everyone. I've recently joined this community and this is my first post. I have a class called Numerical Calculus where the assignments often require the input and representation in a GUI of various matrices. So I've been looking for ways …

Hi, I was wondering what programs out there would be able to do the following: I have several lists of things and would like to be able to have these display as dropdown menus which are dependent on the dropdown choices that precede. For instance, in dropdown menu #1, I …

I am currently writing a program which will perform binary to decimal, decimal to binary, hexadecimal to decimal, decimal to hexadecimal conversions, 1's compliment, 2's compliment, and show the list of boolean algebra rules. I have created the JFrame and the JButtons to create the GUI however, I cannot figure …

Hi everyone, Im new to site and new to Java - have an assignment in Hangman - to date I have created the Hangman class and coded the tester so its working with 1 word! I have also coded the hangman component which is currently static and displayed on opening …

Considering no one seems to be-able to answer my other thread I'll try simplifying this one. I have created GUI frame which contains a menubar at the top. I have several methods as well as a method which paints 5 circles onto the frame. When I call that method, by …

The application will ask questions like: What comes after D? A child is expected to answer the question and the application will inform the child if the answer is correct or wrong. The application will ask a total of 20 questions. After all 20 questions have been answered, the application …

I have no idea whats wrong here, i am fairly new to java.. heres my code.... [CODE] private JPanel pnlLogin, pnlFinalLogin,pnlUser, pnlPass = new JPanel(new BorderLayout()); btnLogin = new JButton("Login"); lblUser = new JLabel("Username:"); lblPass = new JLabel("Password:"); pnlUser.add(lblUser, BorderLayout.WEST); //pnlUser.add(txtUser); pnlPass.add(lblPass, BorderLayout.WEST); //pnlPass.add(txtPass); pnlLogin.add(pnlUser, BorderLayout.WEST); pnlLogin.add(pnlPass, BorderLayout.CENTER); pnlLogin.add(btnLogin, BorderLayout.EAST); …

[CODE]# File: Manager.py from Tkinter import * class Manager: def choose(self,master): tasksf=Frame(master) tasksf.grid(row=1,column=0,padx=3,pady=3) Label(tasksf, text="Task ID:").grid(row=0,column=0,padx=3,pady=3) Label(tasksf, text="Description:").grid(row=1,column=0,padx=3,pady=3) Label(tasksf, text="Start Date:").grid(row=2,column=0,padx=3,pady=3) Label(tasksf, text="Deadline:").grid(row=3,column=0,padx=3,pady=3) self.tid=Entry(tasksf) self.tdesc=Entry(tasksf,width=25) self.tstart=Entry(tasksf) self.tdead=Entry(tasksf) self.tid.grid(row=0,column=1,padx=15,pady=5,sticky=W) self.tdesc.grid(row=1,column=1,padx=15,pady=5,sticky=W) self.tstart.grid(row=2,column=1,padx=15,pady=5,sticky=W) self.tdead.grid(row=3,column=1,padx=15,pady=5,sticky=W) def asdfg(self,master): print "dsgsfd ",v def __init__(self,master): master.title("Manager") menuf=Frame(master) v = IntVar() Radiobutton(menuf, text="Tasks", variable=v,indicatoron=0, value=11,command=self.choose(master)).grid(row=0,column=0,padx=5,pady=5,ipadx=5,ipady=5) Radiobutton(menuf, text="Meeting", variable=v,indicatoron=0, …

I was wondering is there a good IDE for python /wxpython/pygame? I was wanting something that would do all 3 very good, for when I do finally jump to a GUI... I was messing around a little with pygame, and I noticed it dose not like the python IDLE...

Does anyone have a code example for using the mouse wheel with the Tkinter GUI toolkit handy?

Hi there i m new to GUI programming and i have started it from midlet. the problem is, i have made separate classes for each page/form that is to be displayed on a mobile screen but dont know how to link them. Like i want when my login successful, my …

i m trying to write a gui java program. i have a main screen, i declared my object in the main screen class. in the main screen, i will call 2 jpanel. from different class how can i make the 2 jpanel use the same object i declared on my …

hi, can anyone help me with my assignment, I'm new in c++ and any help will be much appreciated: "You must design, implement and test a simple board game. The design should follow object oriented principles and use the UML tools that were introduced earlier in the module. The coding …

Hello DaniWeb community! I come to you in need of some guidance on a quite frustrating problem. In a nutshell, I am building a java system in which users can keep track of weather forecasts at a list of registered locations, which they can add or remove from their "watchlist". …