Software Development Forum

Hi, I am brand new to programming all together and was kind of thrown into a programming class without much help and I have struggled with my homework for this week. I have to create a code to write an ASCII table using Python 2.6 . Here is the actual …

Hello:), I am returning to a theatre ticket booking project after about three months and trying to get my head around how to show the prices in a list box (lstTotal). I have three radio buttons three for three ticket types. Adult Full Concession Friend When one of these is …

[code=c]MailMessage msg = new MailMessage("myAddress@hotmail.com", txtTo.Text, txtSubject.Text, txtBody.Text); SmtpClient client = new SmtpClient("something"); client.Send(msg);[/code] Both the address "to" and "from" are hotmail addresses. Instead of "something" I tried pop3.live.com and smtp.live.com, but they both didn't work. Can someone help me? And I have a second question. If my "from" e-mail …

Hi I am busy working with biological sequences, but I am having some problems to finilize my script Let's say that I want to compare two dna sequences i.e seq1='ATGGAGGCAATGGCGGCCAGCACTTCCCTGCCTGACCCTGGAGACTTTGACCGGAACGTG CCCCGGATCTGTGGGGTGTGTGGAGACCGAGCCACTGGCTTTCACTTCAATGCTATGACC TGTGAAGGCTGCAAAGGCTTCTTCAGGCGAAGCATGAAGCGGAAGGCACTATTCACCTGC CCCTTCAACGGGGACTGCCGCATCACCAAGGACAACCGACGCCACTGCCAGGCCTGCCGG CTCAAACGCTGTGTGGACATCGGCATGATGAAGGAGTTCATTCTGACAGATGAGGAAGTG' seq2='ATGGAGGCAATGGCGGCCAGCACTTCCCTGCCTGACCCTGGAGACTTTGACCGGAATGTG CCCCGGATCTGTGGGGTGTGTGGAGACCGAGCCACTGGCTTTCACTTCAATGCTATGACC TGTGAAGGCTGCAAAGGCTTCTTCAGGCGAAGCATGAAGCGGAAGGCACTATTCACCTGC CCCTTCAATGGGGACTGCCGCATCACCAAGGACAACCGGCGCCACTGCCAGGCCTGCCGG CTCAAACGCTGTGTGGACATCGGCATGATGAAGGAGTTCATCCTGACAGATGAGGAAGTG CAGAGGAAGCGGGAGATGATCCTGAAGCGGAAGGAGGAGGAGGCCTTGAAGGACAGTCTG CGGCCCAAGCTGTCTGAGGAGCAGCAGCGCATCATTGCCATACTGCTGGACGCCCACCAT AAGACCTACGACCCCACCTACTCCGACTTCTGCCAGTTCCGGCCTCCAGTTCGTGTGAAT GATGGTGGAGGGAGCCATCCTTCCAGGCCCAACTCCAGACACACTCCCAGCTTCTCTGGG GACTCCTCCTCCTCCTGCTCAGATCACTGTATCACCTCTTCAGACATGATGGAC---TCG' Thus my aim is to identify …

Hi I want to learn network programing, but I dont know where to start. I want to do windows networking. Help please

I am working on an assignment for school and i seem to be having some issues. I am using OpenGl with free glut, and attempting to animate a pendulum. I can draw out the pendulum, but cannot determine how to make it swing. I have to make it swing from …

hi all i m facing problem populating jtable with the data of database !m using arraylist to populate jtable .but the problem is that m unable to add databse data into jtables.i m only getting the last row elements of databse. i should be getting this data in the jtables …

Hi, I created a previous thread of re-sizing dynamic arrays. I got the answers to that question and I could re-size the dynamic arrays but when I tried to apply similar steps to creating a dynamic array of struct, my program compiles but crashes when i try to run it. …

I'm currently choosing which data structure to use for my data logging. Just want to ask for suggestion which type of data structure is better. It has limitation on memory either store in microcontroller RAM or SD card. - I can't know the total type of logging it has. (for …

ım doing a c# security program this detect the desktop, any human musnt exit from program with use the windows types . what codes ı need

Hi everyone, Can you tell me a way to get the file path (filename) of a file when I "open with" it with my program. I mean that if I open a certain file with my software, I should get the file path of the file. Please Help:)

[COLOR="red"]This is Reservation program full code written in JAVA <from the web> No Problems are in running process. I'm required to convert it to C language.[/COLOR] -- [COLOR="Green"]1- these are lines that i did not understand it. <could any one explain>[/COLOR] a. private static DataInputStream k = new DataInputStream(System.in); //what …

Guys help me please, the equation on 2/3 is giving the waterTemp to 0; how come it is not changing? and also, if the nWaterTemp reached 20.00or somewhere 20.00 to 21.00; it is supposed to print that "THe kettle is now on "Help please [CODE]#include<stdio.h> #include<stdlib.h> #include<cstdlib> #include<time.h> void wait …

I'm attempting to create a program where the login and password will be verified on an SQL database of user information. I keep getting the error "SQL Execution was unhandled" I marked the code that was causing the error in red. I'm using Visual Studio 8. Keep in mind I …

Hi, I have to use Java to build a scrapper, that takes a product name and searches for that product on an e-commerce website. I understand that I will have to use an external library that would parse the html page for me, given the link. But how do I …

hello every1 actually m new to vb.net, i have installed oracle 9i on my system and i dont knw how to connect even a simple form to my sql table in which i have two fields named first_name and last_name, the name of the table in sql is user. can …

Hi, Guys i have an xml file containing near about 6,000 thousands questions in rtf format while inserting these questions into sql server it will give me an error, 2500 records inserted successfully .......... but from that point it will show error, [COLOR="red"]The CLR has been unable to transition from …

Hi, I am create new setup for my project(.exe). While i am click on exe it will throws an error microsoft has encounred a problem we need to close it. System.data.sqlclient.sql what happens , i am installed in another PC it will work fine . I have allready .netfrmawork an …

I've been working on a Linked List assignment. I completed it but I still have a problem on deleting an element that has a predecessor or after an element and inserting an element after an element...can anyone give me an idea? This is what I have so far [CODE] #include …

[CODE]#include<stdio.h> #include<stdio.h> #include<stdlib.h> struct bst { struct bst *left; int info; struct bst *right; }; struct bst root; void create(struct bst*,int); void preorder(struct bst*); void postorder(struct bst*); void del_leaf(); void del_singlechild(): void main() { struct bst *p; int n,c; char ch; root=(struct bst*)malloc(sizeof(struct bst)); printf("\nenter the info:"); scanf("%d",&root->info); root->left=root->right=NULL; do …

Hello, We stduying the 8086 and 386 using boarland linker. while stduing for a test I have I came across a queation about menaging and printing 64bit numbers. the numbers are represented as an array of chars (8) and I need to implement a rutine that puts the number in …

We are asked to input 10 integers where in we need to display: 1. The sum of all the odd numbers 2. The sum of all the even numbers I do not know how to make a statement and i do not know whether to use for or while and …

I use VS2008 where I have a program where I have about 20 tabpages with datagridviews and textboxes. But when it comes to printing windowsforms the sollution is just not good enough, and of course på programming skills is not good enough either. I want to print out the data …

Hello c++ experts. Please help me with this kind of program >.< i wanted to make my integer converted to string. For ex. I input "1" and the output must be in string "one". Sorry if i request this just need this for my homework. Thanks in advance!

Hi, When i use realloc to re-size my array it is re-sizing it correctly but my some of my data is getting lost. Strange thing is that If I don't use realloc, I can still re-size my array by just increasing the index before inserting the data. In this case …

Problem 4 – makeScarf(scarf) Let’s knit a scarf! With Python today we are knitting recursively. Your main program should be contained in a recursive function called makeScarf() which takes a string: your scarf that will be printed out in the end. You may use other helper functions as needed, but …

I am working on a "searching" program. But it always returns a "." as the up directory or whatever. And I can't do an if statement to check if its a period or not. The goal is to get the only name of the folder in that directory. There is …

Hello, I need to write code which detects whether keystrokes are injected by applications (with SendInput, keybd_event) or are genuinely coming from the keyboard. I came across a possible solution: creating a WH_KEYBOARD_LL hook and checking the INJECTED flag. So I've made this so far: [CODE] HHOOK g_hHook; LRESULT CALLBACK …

Hey - I'm looking for something similar to using vectors and pointers that I've used before in C++; unfortunately, it doesn't seem like there's an equivalent function in VB.net. What I have is a copy of the array behind a multi-line Rich Text Box, and I need to separate the …

hi, u are so good at c, i saw some program that i looked for, but i dont look at result, i need a program, for beginner level of c programming (because i am beginner), converting binary to gray, gray to binary i only know while, if, for, a little …

Hello, this is my first thread in DaniWeb.. I'm still a VB.net beginner and I like programming so much. I had a problem when I was making Tic Tac Toe code, it was just for practicing so I have created a form and added 9 buttons and named them btn1, …

I have a problem to determine Easter Sunday based on the algorithm invented by Carl Friedrick Gauss in 1800. I have written my code and double checked the Math several times but not matter what year I type in it tells me that Easter is on April 9th so I …

If I need a string or an int from the user, how can I make sure that that is what they inputted? The lame way of putting EVERYTHING in strings and then somehow check? Or maybe throw-catch? I tried the try-catch but had a few problems. The examples I saw …

i tried to make a executable jar file.a program as follows [CODE]import java.io.*; class studentmarks { String name; double engmarks,phymarks,chemmarks; double tot,avg; public studentmarks(String s,double p,double e,double c) { name=s; engmarks=e; phymarks=p; chemmarks=c; } void compute() { tot=engmarks+phymarks+chemmarks; avg=tot/3; } void display() { System.out.println("nameis:"+name); System.out.println("totalis:"+tot); } }[/CODE] i saved it …

how to send mp3,avi(large) files via socket...small files with size less than 100kb is possible but how to send large file..

Many of the software development forums have a sticky thread featured at the top for recommended resources on getting started with or improving one's knowledge of that language. VB.NET currently has no such resource listing. I personally do not work with VB.NET, but if those who do would like to …

Simple resources loader tool which help to find some file in classpath and load it's content with respect to sanitizing policies.

Hello, I`m just starting to get into the basics of C++ and I have to create a following program - basically the user has to input an integer and a digit of their choice and the program has to check whether the square of that integer contains that specific digit …

i have to convert a string into ascii format and then into it's binary. I know how to convert between int to binary using toBinaryString, so how to convert ascii to int. Or is there any other way to convert string characters into binary form. In short suppose there is …

Hi! It's me again :) I have failed with my C++ code once again. This time it's with vectors. [CODE]string show_actions(){ vector<string> actions; actions.push_back("end"); actions.push_back("hunt"); vector<string>::const_iterator iter; cout <<"All of the possible actions are : " << endl; for(iter = actions.begin(); iter != actions.end(); ++iter){ cout << *iter << endl; …

Hello, I have been looking at using Beautifulsoup python module to make changes to some static html files a total of 167 files, but being a newb in programming was wondering first how to open, read/process the file, then write it, close it and then open the next file thus …

ok so far i got this!!! but what i realized is that when i run the ouput 1 2 3 4 5 it gives me the correct output but if i put the value as 3 6 7 8 4 !!! it arranges the number as 3 4 6 7 …

I'm new at this so sorry if my vocabulary and stuff is totally off. With the following syntax, my goal is to call the choose_number function, which, when given two arguments (integers), returns one of those two at random. I run it multiple times with a for loop but it …

I'm attempting to create a program where the login and password will be verified on an SQL database of user information. I keep getting the error "SQL Execution was unhandled" I marked the code that was causing the error in red. I'm using Visual Studio 8. Keep in mind I …

Hi everyone, I was wondering if anyone could help - at the minute I have a program that records how many bytes are received over a set interval (for example, 500 milliseconds). How would you calculate how many megabits have been received per second if the sampling interval will always …

hello every1 i would appreciate if any1 cud help me with setting an image to label what i want is a label with no text jst an image display on the label... thanks in advance!

How do i write these in a flowchart: ConverterMenu1 cm1 = new ConverterMenu1(); CurrencyConverter cc = new CurrencyConverter(); MeasurementConverter mc = new MeasurementConverter(); Please help me quick!

I am having trouble finding the real trouble in my program to insert into a Binary Search tree. [CODE] //BST #include<iostream> using namespace std; class bst { public: int data; bst *lnext,*rnext,*root,*prev; public: bst() { lnext=rnext=root=NULL; } bst* addBST(bst *p) { if(root==NULL)//if tree is empty { root=p; cout<<"\nRoot Inserted!"; return …

Hi there pleasse help. I get the warning C4700: uninitialized local variable 'BottlesLeft' used. [B]Here is what the CalcNrCases is supposed to do:[/B] A value-returning function called CalcNrCases( BottleType, NrBottles, BottlesLeft ) that will calculate and return the number of full cases (NrCases) as an integer. It will also calculate …

hello great community of developers, I have a problem with my code. I am new ... wx.panel want to put () to the main mdi window code. and I would like to know how to open and close a main module is mainly run and then open medi.py nada.py and …