Software Development Forum

on line 53 it says menu is undeclared. but if i bought menu first then mcdonalds is undeclared. does anyone know how i can sort this out? ty [CODE] #include <iostream> using namespace std; double money = 50.00; void Mcdonalds() { cout << "Welcome\n"; cout << "How can i help …

Hello everyone, My file has lines like: >9|102396631|genome..... CCACTTTCTCTCCGCGCTGGGTTGAACATGGTACATCAGACTCCCTGAATCTGTCAGATC TCTTGGTTGCTGTTGACAACTAAGACTTCGGAGCCTGGAG_GATTTGTTGAGGGGGAGCA GTTCTGGGTGTCCTCTGCTGTGACTGGGCTCCCGGCCTCTTGATAATGCGCAACAGCTGC GGTAGAACATCTCATTCCCAG >9|102362951|ENSRNOS.... I want to delete blank lines from this file please help me... Thanks

Hello, everyone! I have a problem with memory free. Here is the necessary code to understand the problem: [CODE] void fillArray(char** referenceArray, FILE* grid) { //Chaîne qui va contenir une ligne du fichier. char* lineContent = malloc((width + 1) * sizeof(char)); //Pour contenir le "\0" int i, j; for (i …

[code] i read that a method that is is using throws clause must be mentioned in the try and catch block.So when we use "throws IOException" in the following program why dont we use try and catch import java.io.*; class testthrows { public static void main(String args[]) //throws IOException { …

Hi, I am trying to write some code to insert coordinates which are taken from the mouseClick position and then added to a 2D array. The user should click 6 positions on a panel and these positions should be stored in a 2D array. I hope you can help. Thank …

How do I import a variable from another function in the same class [code=Python] class W(object): #my class def variable(self): #one of my functions f = 5 def printf(self): #what do i put here to import f from the function variable... #I'm currently working with python 3.1. #I know its …

I have a main form and I have menu's that open up within the form, but when I open a menu they open off the form. What do I need to do to make the forms open at the center of the main form? Thanks

[code=c++] #define MIN_PASS_LENGTH 6 #define MAX_PASS_LENGTH 12 #define NUMBER_OF_PASSWORDS 3 #include<iostream.h> #include<stdlib.h> #include<time.h> #include<conio.h> #include<fstream.h> #include<string.h> //int i; //letters //int j; //numerals char rand_small_letter() { int nHigh = 122; int nLow = 97; int small_letter = ((rand()%(nHigh - nLow + 1)) + nLow); //values from 97 to 122 return (char)(small_letter); …

Hello~! ...again.. I got some help from you guys a while ago with this same app because it wouldn't run on winxp. It runs fine now, but my brother is still telling me he cant get it to work right...so rather than go through all the trouble of trouble shooting(he …

Hello.. Im trying to pass an integer to a function by adress because I want to change the value of the integer in the function. But it will not.. please help. Here is my function call: [code=c] insert_sorted(&VH, &L, n); [/code] Here is my function: [code=c] void insert_sorted(VirtualHeap *VH, LIST …

Hi I want to store value from a row into a variable. I have used the following coding but it is not working properly. It is generating the following error: [B]Index was outside the bounds of the array.System.Data[/B] Please note that the table contains only one row. [code] objSqlConnection.ConnectionString = …

Hi I use the reporting services to generate the report.I use query like "Select Distinct(ID) from Table1".In that query Its generate the number of ID ,So In report user able to several "ID" at one time,so I think if I can use combo box then user can select ID which …

Hi. In my attempts to create an email client, netbean's GUI builder has made me very unhappy... so, I decided I'd rather code it by hand... not my best idea, but whatever. Now, I'm trying to nest a Vertical JSplitPane in a Horizontal JSplitPane, and I can't see the left …

hello, i was just wondering as to what is the major difference between the Endswith() and Equals() method in .net (c#) ? I wrote the following code for string comparison n also for numerals by using Endswith method however even if i use Equals method i get the same output …

Hi I am developing a windows application. For your infomation FRONT END : C# (VISUAL STUDIO 2008) BACKEND : SQL SERVER 2008 In a single form I have an option for add and remove books. Two different buttons are used(Add and Remove Books). When I click on Add button the …

[code]Excel.Application ExcelApp = new Excel.ApplicationClass(); ExcelApp.Visible = false; String WorkbookPath = filename; Excel.Workbook ExcelWorkbook = ExcelApp.Workbooks.Open(WorkbookPath, 0, false, 5, "", "", false, Excel.XlPlatform.xlWindows, "", true, false, 0, true, false, false); Excel.Worksheet Sheet = (Excel.Worksheet)ExcelWorkbook.Sheets[1]; DataTable newTable = new DataTable(); string strConn = "Provider=Microsoft.Jet.OLEDB.4.0;Data Source=" + filename + ";Extended Properties= Excel …

i need to how to give codings to buttons that are present in confirm dialog box. For Example if there are two buttons as "YES" and "NO" and if i click "YES" then the program should close. If i click no then th dialog box should return to the program. …

this is our homework... // make a c program that will ask any number from the user. //Output all numbers multiples of 3 from number to 30. [ICODE]// make a c program that will ask any number from the user. //Output all numbers multiples of 3 from nuber to 30. …

Hi all, I have made (just to learn C#) a calculator program, which is working OK. I made a Round button class for it, but the edges of the buttons still look "crispy". I set [B]SmoothingMode [/B]and [B]PixelOffsetMode[/B] to [B]HighQuality[/B] but it seems to have no effect. Is this once …

Hi, I am modifying a software in delphi, The software is in Turkish, but it cannot show special Turkish characters properly. Can anyone help me solve this problem.

Hello, I have an application written in python and Tk. My application is to be scriptable with python, i.e., the user gives a small piece of code written in python, and that is to be executed by my application in a different interpreter, with different set of local variables. I …

Hello to all, [INDENT]I am making an application which will only take images, convert it into binary image using a threshold. Now this binary image will be segmented horizontally on the basis of black pixels. In the attachment [ATTACH]10789[/ATTACH], this is the original image file. Now i have to segment …

Hello, I have a small question. I have done some projects in C++ and Delphi. In C++, when I work with classes, I always use pointers.I make functions and classes that takes pointer to a class as an argument. But in Delphi, like this example: (some class).Create(Owner: TComponent) function take …

Hi All, I am using the below code to write into a text file [CODE] # Write into log file inp=file(Doc\Log.txt, 'w') inp.write('Log file start') inp.close()[/CODE] The text file 'Log.txt' is present in 'Doc' folder inside the application folder. Now I want to create a text file with a time …

Hi All, How can I accomplish splitting of data(string). For eg, If I want to split the 'Date Of Birth' ( given in the format dd/mm/yy) into its constituents dd, mm and yy separately. Specifically, I have a DOB field in my database(sql) and in the form, I have three …

I Simple want when user click on the combo box .the other corresponding detail should come in a text box.i have written a code but it is not working .Kindly help me. any help would be Greatly appreciated.here is the code what i have written. [code=vb] Private Sub CboEmpName_Click() Dim …

[code=c] #include <stdio.h> int main() { printf("hello\n"); return 0; } [/code] It's all the more frustrating because I've designed stuff MUCH more complicated on this computer. My errors seem to be all linking errors. I've done all I can think of, which was really just to make sure my subsystem …

If I wanted to save the binary information of an executable as a string object in a .py file what would be the easiest way to go about that without receiving null byte and EOF errors.. I've messed around with converting each char to its ordinal and then separating them …

this script give me a memory error in parse()...what is a memory error and how can i fix it? [code] import cgi class COM: def __init__(self): f=open('C:/site/commentlog.txt', 'r') self.lines=f.readlines() f.close() def writecom(self, post): f=open('C:/site/commentlog.txt', 'a') f.write(post) f.close() def getcom(self): try: form=cgi.FieldStorage() q=form.getvalue("posts") if q: writecom(q) return q except: return 0 …

I feel like I'm losing my mind... I uninstalled wxPython this morning and was going to reinstall with the latest version as I'm having peculiar problems with UliPad that I just downloaded yesterday. Well after uninstalling the wx package and docs & demos I went to the wxPython page and …

I am trying generate even fibonacii numbers less than four million, but I keep getting negative numbers at some point and eventually it converges to a positive answer, which is obviously wrong. Can anyone please help me out? #include <conio.h> #include <stdio.h> void main (void) { clrscr(); int f1=1; int …

Hi there, I need to write a program that draws a clock face with a time that the user enters in two text fields (one for the hours, one for the minutes). As far as I can tell I have all the code written, it's now just a matter of …

Hi there, I have the following string which is tab seperated [code]dasj dhsahdwe dhasdhajks ewqhehwq dsajkdhas edward das dsaw das daswf fjdk ewf jken dsajkw dskdw hklt ewq vn1 daskcn daskw[/code] How can I format it in python in order to make each column to have the width of the …

Ok so for the last couple of days I have been struggling with file handling. Here is my problem I create a new file and write some text into it. Then I open it again to add more text to it but somehow the new text is being written in …

So after some scrambling around trying to find a good beginner programming language, i have found python, and with my ultimate goal being game development, also pygame. I have just started learning some basics, and I was going through a tutorial when i ran into an error that im not …

What is the difference between these two methods; [CODE=python]# Solution 1 list1 = ['a', 'b', 'c', 'd'] temp_list1 = list1 for i in range(len(list1)): temp_list1[i] = "1" print list1; # ['1', '1', '1', '1'] print temp_list1; # ['1', '1', '1', '1'] # Solution 2 list2 = ['a', 'b', 'c', 'd'] …

If I simply just want to tokenize the first element of a string and then output the remainder of the string, how can this be accomplished? thanks [CODE=c] #include <stdio.h> #include <string.h> int main(){ const char* line= "0 firstline"; char* l = strdup(line); printf("beforeToknization:\t%s\n",l); char *tok = strtok(l," "); printf("firstToken:%s\trestOfLine:%s\n",tok,l); …

I'm trying to start writing tests for all of my functions as per Test Driven Development. My question is, say I construct a test for "rotate vector". It would be something like this: [code] int TestRotateVector(const Vector &V) { Vector Original(1.0, 2.0); Vector Rotated = Original.Rotate(10); //rotate 10 degrees if(Rotated …

How do I format a decimal number so that, if there are one or two digits to the right of the decimal point, that shows up (e.g. 123.45) but, if there are digits of zero to the right of the decimal point, the number is formatted as a whole number …

I have a program in which i open a a text file, access it's values and create and array with it. for example the text file may contain these values: 1 44 3 4 33 6 7 8 61 10 ; that's 10 integers what c++ tools could i use …

OK, I haven't done much with Serialization. I have a simple program that creates four JPanels with different background colors and adds them to a larger JPanel using a 2 x 2 GridLayout. That larger JPanel is added to a JFrame. I've written my own serialization code to override the …

i am an IT STUDENT MY INSTRUCTUR HAS GIVEN ME ATASK TO BUILD WEB BROWSER IN JAVA AFTER GUI WHAT I HAD TO DO PLEASE HELP ME!!! NOT GIVE ME THE CODE JUST TELL ME EASY STEPS COMPLETE IT THANKS!!!

I've managed to figure out how to create tables in a dataset, fill them with data, and link one of those tables to be displayed in a DataGridView. It works great when the selectionmode is by row, row header, or cell, but unfortunately for this project I'd like the user …

i want to playing mp3 file with vb.net. how can i do this? regard Naruse

Hello everyone, I am not much of a programmer but have some limited experience with vb.NET, so please bear with me. I have written the following code to create a dataset and fill it with three different tables, one of which is empty to begin with but is populated successfully …

[code] string s; cout<< "Enter name: "; cin >> s; cout<<"\n"<<s; [/code] on running this i need: Enter name: Tejesh Kinariwala Tejesh Kinariwala it is showing: Enter name: Tejesh Kinariwala Tejesh so how to get the input till user hits return key, instead of breaking it at space

i've wrote a code that read and write to some files, and i have a segmentation fault when i'm running it in the g++ (in the visual studio i don't have any problem like that..) anyway, i think the fault may come from this line, can anyone tell me if …

I need a help in designing form in vb.net. In my project I have to design a form to save the company's applicaton form details.the applicaton form is of two page.I have to make the form design catchy so that data entry is easy. A section in the application form …

gives me error main /* The purpose of this lab is to open a text file and then make a copy of it */ #include <iostream> #include <fstream> #include "Interface.h" using namespace std; int main() { //open up file to be read from string input; ifstream in; cout<<"enter file name …

I'm trying to write a program that asks the user for a number between 1 and 10, then prints a line of that many “X"s. The program compiles, but I cannot figure out how to make the variable 'total' print X's instead of a the actual number, if that makes …