Software Development Forum

I'm having a lot of trouble finding enough RAM for a program I'm writing on Vista 64 Ultimate system, even though the system has 8GB RAM and only 2GB is used. I tried to see how many 10 million byte blocks I could allocate using malloc(), and the compiled program …

Currently I'm creating application to work with PDF documents, just for challenge. I want to know if there is better solution to my idea of possible approach. I broke down application GUI to four main components toolbar with image icons, jpanel for thumbnail preview, jpanel for single page view and …

[COLOR="Red"]The program is given at the bottom[/COLOR] To compile java programs in the command prompt I use the following command: C:\jtemp\MyPack>javac AccountBalance.java -d . Only then are the classes compiled and I am able to run the main() function. When I execute the above command a folder "MyPack" is created …

Hello everyone, My file has text like: gnl|dbSNP|rs13484118 gi|62750812|ref|NC_005111.2|NC_005111 95 20 1 0 68 87 31017559 31017578 4.4 32.3 gnl|dbSNP|rs13484118 gi|62750812|ref|NC_005111.2|NC_005111 91.67 24 2 0 63 86 35247737 35247714 4.4 32.3 gnl|dbSNP|rs13484118 gi|62750812|ref|NC_005111.2|NC_005111 91.67 24 2 0 64 87 40549054 40549031 4.4 32.3 gnl|dbSNP|rs13484118 gi|62750812|ref|NC_005111.2|NC_005111 92 24 2 0 63 …

[code=c#] using System; using System.Collections.Generic; using System.Text; namespace selectionsort { class List { public int[] arr = new int[10]; public int[] arr1 = new int[10]; public int n,h1; public void read() { Console.WriteLine("array size should be less than or equal to 10"); Console.Write("enter the array size "); n = Convert.ToInt32(Console.ReadLine()); …

I often hear the saying that iostream is inefficient in terms of performance, and it is better to use printf family if type-safe is not concern. But as far as I know, the static type checking (is this thing people call the 'type-safe' do?) is done in the compilation, and …

Hello, I happen to be a novice in the realm of C++, and I'm currently confused due to this error when trying to run my application: "Assertion Failed. Expression 'stream != NULL' ". I've looked it up, and nothing that comes up can answer why it gives me said error. …

Has anyone tried to write [URL="http://support.microsoft.com/kb/307398"]this tutorial [/URL]using VC++ 2008 Express? The article claims to be written with VC++ 2005. But I thought 2005 and 2008 used compatible versions of CLR language. I'm getting all kinds of compiler errors -- for example [icode]String* str;[/icode] instead of using [icode]String^ str;[/icode] and …

I have been trying to build a Java program to prompt the user to enter the radius of a circle and the diameter, circumference, and area will be output through a "System.out.printf" statement. I can get the program to prompt for the radius and it will display the diameter, but …

Dear Sir, I have got a serious problem to understanding of the answer. The question is: Create the first half of a game of rock, paper, scissors. Ask the user for R,P or S. Get the computer to generate 0,1 or 2. Now convert the computer's number to R, P …

I'm stumped right now, I cannot figure out how to code something to get information from another form. This is what I'm trying to do: [code=VB] Private Sub Button1_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles Button1.Click If TextBox1.Text = "01" Then 'TextBox1 is in form 2. PictureBox1.Image = …

Hi all, it's my first time in this forum, I hope you can help. I've searched the web for a long time, couldn't find help, yet. I have a listview that displays a list of PDF files. When the user clicks on a row (in the "selectedIndexChanged" event), I display …

Dear mates, I am am frustrated and bored to learn how to get or calculate coordinates data for Java Graphic API. for ex the GeneralPath 's function curveTo() takes 6 parameters namely x1,y2,x2,y2,x3,y3.I put some random coordinates data into these function and got a crap drawing. :( I want to …

I am having a problem on how to count numbers inside text area. . . example: In my text area I have 10 numbers. 12, 06, 31, 22, 53, 28, 96, 71, 10, 47 the the program should count how many 0,1,2,3,4....9 excluding the comma. I don't know how to …

I'm using this code to colour individual items in a listbox, but the problem i am having is it colours all previous items with the new colour. How can i colour each induvidual item without this happening? Here is the code I'm using: (_colour is a global int) [code=c#]private void …

Hie guys.How do you write a vb function that returns the frequency of each word that appears in a given text file.e.g.if the word "the" appears twice,it would return "The word 'the' appears 2 times".This has to be done until the end of the file without searching for a particular …

here is the code.... [CODE] #include<stdio.h> int main() { int *k; *k=10; printf("%d %d",k,*k); return 0; } [/CODE] it compile perfectly. but on executing it is giving segmentation fault. where is the problem?

I have to open a file whose name i am constructing by concatenating various inputs from the user. If I write: [code] string s = "filename.csv"; ofstream fout; fout.open(s,ios::app); [/code] it gives error for using s in fout.open(). It says it is a wrong form. I need to use a …

Hi All, I want to know how to bind data to DataGridView Control. I have seen examples on google nd other sites. but all examples use DataBind() while in my program, it shows DataBindings() in intellisense. I cant find out how to do this. I have to bind data from …

Hello, I'm currently working on a little soft to plot some data from CSV files. I've got two problems. The first one is on CSV opening in procFile method. When I try to open a file with a path which own "é" characters for example, it raises an error. I've …

Hi. I'm new to java programming. I have some questions: 1) Does every java source code's [B]class name[/B] (the name after the [I]class[/I] keyword, e.g. [I]class[/I] [B][I]Hello[/I][/B]) has to be started with an uppercase character? 2) Does the java source code's [B]file name[/B] (e.g. [I][B]Hello[/B][/I].java) has to be [U]exactly[/U] the …

Hello, I am trying to compile a set of files. I got fustrated to the point of taking the actually instructor files from the book and compiled them. I am using AndLinux and the g++ compile to run my programs. If anyone is familiar with the book "Accelerated C++" I …

Here is my final product: [code] #include <iostream> #include <fstream> #include <iomanip> #include <string> using namespace std; void printGrade(int oneScore, float average); void printTable(int scores[], int id[], int count); float computeAverage(int scores[], int count); const int MAX_SIZE = 21; void readStudentData(ifstream &rss, int scores[], int id[], int &count, bool &tooMany) …

Hello again, My assignment is to calculate a 10% bonus based on sales figures. I have to use a main() function, obviously, and 3 void functions, getSales(), calcBonus(), and displayBonus(). I'm pretty sure I have the functions coded correctly, I'm just having some issues getting them to actually run correctly …

I've searched for days on how to find the correct way to convert a string to a float and then double the user entry. Any help would be appreciated. Thanks. #include <iostream> #include <cstdlib> using namespace std; bool FloatInput(char []); void main() { float floatValue; char buffer[100]; bool validInput; do …

Hi, I would like to use textbox to accept date in VB 6 instead of using dtpicker. The text box should contain oblique sign like ( [B] / / [/B] ) to enter dd/MM/YYYY type date during form load. I tried to use Microsoft Mask Edit control also but it …

hi, i'm creating application using visual basic 2008 express. It's great acctually, but I'm having problem creating report with it. Can anyone suggest reporting tools that can be used with VB 2008 express? I tried microsoft report viewer 2008, and it seems that vb 2008 express doesn't support report design …

Hi, I'm working on a program to convert Celsius to Fahrenheit, but I have a problem when I run a check to make sure that input is not a letter. My problem is that if the user inputs a 0 it catches it with the [code=C++] if(num == 0) { …

I have a combo box which is in set to be a drop down list. How do I change the label text based on which ID is selected in the combo box. How do I make the label text change to the corresponding row as the ID? Thanks

hi.. well i have a gridview on a page and when the user selects the gridview row then that gridview row should be redirected to a new page. this new page has another gridview which i need to populate with the selected gridview from previous page. can somebody help me …

Hello, I had to creat the following code that displays a table depending on the number te user entered. [code] int main() { int n = 0; const int base = 4; std::cout << "Enter max: "; std::cin >> n; std::cout << " "; for(int i = 1; i<= n; …

Hi, I'm looking for some help with this short program I am writing... I'm trying to make the sure that the user enters a number when it asks for the temperature in Celsius, and when the user enters a number it works. However if a letter is entered it all …

hii everybody, I have a weird problem with a program for solving sudoku puzzles. I am representing the puzzle as a list of lists of lists containing all the possibillities for a single square and my problem is that when I try to remove a single appearance of a number …

Hello all, I'm trying to approximate a sine wave using bezier curves (for rendering speed over drawing many straight lines). I'm trying to follow the non-C# code specified down the page at: [url]http://commons.wikimedia.org/wiki/File:Harmonic_partials_on_strings.svg[/url] [code=C#] // Produces a sine path as flat point array {PT, PT[3], PT[3], ...} private static List<PointF> …

Hello! I'm trying to make a command line program that converts Celsius to Fahrenheit, and then asks if you would like to convert another number. This is the code I have (below) however when it gets to the point of asking if you would like to convert another number, no …

hi. I'm a newbie in shell scripting as well as the *nix OS. I just wanna ask about the symbol [B]#![/B] that I saw in many shell script examples. For instance, [ICODE][B]#![/B]/bin/bash[/ICODE]. What does the [B]#![/B] symbol means? What's the meaning of [B]$1[/B], [B]$2[/B], [B]$3[/B] symbols? and what does the …

Hello everyone, my file1.txt have sequences as given below: >1|62798264|[COLOR="Red"]rs8174605[/COLOR]|T/C||dbSNP|T/C AAGAGGAGAAAGCAAAGTTGCAAAAGGTGAAAGAGAAAGAAGAGCTAGAGAAGGGCAGGA AGGAGCAGAGTAAGCAGAGGGAGCCTCAGAAGAGACCGGA_GAGGAGGTGTTGGTGCTCA >1|100159271|ENSRNOSNP145|T/A||ENSEMBL:celera|T/A TCTTATAATTAGTCATTGTGATAACTGCTACAAACAAAGTCACAGGATCTTGTGAGAGAA >1|19033646|[COLOR="Red"]rs8173848[/COLOR]|C/T||dbSNP|C/T TTGCAAAAAAAAAAAAAAAAAAAAAAAGCCAGAATCCAGCATAAGTCAAGGAAATCCACT >1|149643853|[COLOR="Red"]rs8173465[/COLOR]|G/T||dbSNP|G/T AACAGAGACAGCTGTGATGTACCCCATGAGCTGGAAAGAGCAGCCCAGCGGTGTCCCAGC >1|101456015|ENSRNOSNP1318|G/C||ENSEMBL:celera|G/C AACTCTTAGAAGTTAGAACCTGGGGTGGAGAGATGGCTTGGTGGTTGAGAGCATTGACTG I want result file which do not have sequences with "rs"number e.g rs8177678, these are colored red in each sequence. so my output file should have 2 sequences: >1|100159271|ENSRNOSNP145|T/A||ENSEMBL:celera|T/A TCTTATAATTAGTCATTGTGATAACTGCTACAAACAAAGTCACAGGATCTTGTGAGAGAA …

Is there a way to use the NumericUpDown control without a maximum or minimum value?

I know how to make random numbers. and How to make random numbers in a specific range. BUT!!! How can you display 'x' random numbers in a given range and make it so the output display lists the numbers in groups a 'y'. For example: I want to display 25 …

Hi, I have my own widgets ( simple one) and want to put them in one file and call them from second file. This is like easygui but with pyqt4. My problem - when I call my widget from second file nothing happens. This is file with widgets (example). [code …

Dear Sir, Could you tell me how can I do this question? Write a program that will readin three numbers nd output a message indicating whether or not the numbers were entered in ascending numerical order. (Equal entries are regarded as being in order, e.g. 4 4 5 is OK). …

hi, just a quick question can somebody please tell me how to restrict the output of the code below to 2 decimal places. [code]VolumeCalc.Caption := FloatToStr(StrToFloat(EngineSizeVal.Text) / 2 / StrToFloat(CylNumVal.Text));[/code] thx for the help.

hai friends, I dont know how to create database dynamically in vb.net.(if a button is clicked 4 databases in access or sql has to be created).similarly by clicking the delete button the specified database should be deleted.can you help me out with the coding.

hi! I'm trying to get the following C++ class (contained in a DLL): [code] __declspec(dllexport) class ThreadManager { public: __declspec(dllexport) static UINT32 setThreadPriority(UINT32 tPriority); __declspec(dllexport) static UINT32 setPriorityClass(UINT32 pClass); __declspec(dllexport) static UINT32 setProcessorMask(UINT32 pAffinity); __declspec(dllexport) static UINT32 changeMATLABSeed(UINT32 inputSeed); static BOOL setHandles(HANDLE* thread, HANDLE* process); __declspec(dllexport) static BOOL testFun(UINT32 testInt); …

Hey i m reading tutrial about rucursion and got code whish isnt complicated or anything but i dunno why it prints the way it does [code] /* recur.c -- recursion illustration */ #include <stdio.h> void up_and_down(int); int main(void) { up_and_down(1); return 0; } void up_and_down(int n) { printf("Level %d: n …

Dear Sir, Please find the attached document for your reference. Could you tell me what is wrong of my answer? [code] program Project1; {$APPTYPE CONSOLE} uses SysUtils; var balance, posNeg, positive, negative: integer; begin randomize; writeln('Get average balance'); balance:=random(10000); posNeg:=random(2); if posNeg=0 then begin balance:=balance*-1-30; end else begin writeln('Positive balance.'); …

I was working on an assignment, and I had finished everything and was cleaning up the code by just adding some comments to it and everything, and when I tried to run it again afterwards, it came up with an error that said "Debug Assertion Failed!" It says "Expression: _BLOCK_TYPE_IS_VALID(pHead->nBlockUse)" …

Ok so I was working on file handling, nothing special just making new (.txt) files and putting some text in it. That works fine the problem is that when I try to read the file from within python nothing comes up and when I try to open the file once …

in my switch program keeps reading wrong input also i know i used way too much fflush(stdin); because stupid printf keeps inputting to the screen so scanf gets bad but i m sure i desinged program nice i dunno why when i like enter num 5 it keeps reading artichokes …

Hello developers, I have been playing around with C++ and wxWidgets for a little time now and I think it is time to make a little useful program I am planning to make a CD ripper and Encoder (re-inverting the wheel purposely for learning) and I plan to use CDRip.dll …