64,152 Solved Topics
Remove Filter  | |
 | Is it possible in C to pass a 2d array without eather of the sizes known? Something like this maybe: [CODE=C]#include <stdio.h> void somefunction(int *array); int main(void) { int array[3][3] = {{1, 2, 3}, {4, 5, 6}, {7, 8, 9}}; somefunction(array); return 0; } void somefunction(int *array) { printf("%d\n", array[3][2]); … |
| | is it possible to set the position of the picture inside a pictureBox? like making a small pictureBox and putting a larger picture inside,,instead of showing only the upper-left most part of the picture,,it would be able to show different parts of the picture.. |
 | I don't understand why can you do this: [code] Employee *emp; if (condition1) emp = new Employee(); else if (condition2) emp = new Manager(); [/code] but not this: [code] Employee emp; if (condition1) emp = Employee(); else if (condition2) { emp = Manager(); [/code] Maybe this is a TERRIBLE idea, …  |
 | Hi all, This following code doesnt update the database. I get the following error message Parse error: parse error in C:\wamp\www\testbin\edit.php on line 41 Please can you advise as to the error. I have worked on this for a few hours now but to no avail. Many thanks [code] <?php … |
| | what is the windows script to add shortcuts to all users desktop? thanks |
| | Hi, I'm having a bit of a problem outputting to a file. I am trying to output each element of a list into a document on a new line and I can only get it to work when all the items in the list are on the same line. The …  |
| | Add More parameters on Select method I need to 1) add a string "All" on top of my dropdown. 2) Add "MyState" parameter on Select Method of object Datasource. 3) On "ddlSt_SelectedIndexChanged" event I need to pass selected State Code to City drop down. pl. help. [code] STATE: <asp:DropDownList ID="ddlSt" … |
| | i was trying to build a glossary section for a web. The idea for the glossary part is that, when users mouse over the term in the glossary section the meaning/definition of the term will appear. How this could be done? Do I need a database for easier maintenance rather …  |
| | Sir, i have a numerical method project. I want to be different, so i try to make a program that can read user input, ex : sin(x+3)^(x*3^x), and find the root of the equation. I already implemented Reverse Polish Notation, and also shunting-yard algorithm. But, i found out that all … |
| | some functionality is not available in .NET class library, so we need to use one the items in the title of this thread. My question is when to refer to which one. Thanks |
| | I am wondering if anyone can point me in the right direction so I can save the returned identity value from one of my stored procedures. How can I save it into a variable. Any help or examples is appreciated thanks!  |
| | Hi all, I am developing a windows application. I have 3 forms: I want to change the backcolor of all the 3 forms to the color selected by the user. I have written the following code to do this. But the backcolor is not changed. [code] In Form1 ColorDialog c1 …  |
| | Hello! I'm trying to write a program, that replaces inscpitions like "\input{C:\FullFileName.txt}" to maintenance of FullFileName.txt. It now looks like [code=C++]#include <fstream> using namespace std; #define shint short unsigned int const char* InS ="input{"; ofstream log ("C:\\Users\\DimOK\\Desktop\\Lat\\TEST1\\log.txt"); bool EqN (ifstream &as, const char *ba, shint l){...} // takes l chars … |
 | Hi I Want to develop the application ,that use for get how much data I download from the internet.Please give me idea. Thanks Tank50 |
| | hello, i was looking at a program someone wrote. I saw something like that: name = (char*) strdup(path); strdup already returns char *, so why do we need casting here? did he do a wrong thing or am i wrong? |
| | Here i am posting again the program for creating the table of contents which are filled according to the user with dynamic arrays but yet the problem regarding the output is not solved ,i know dry run is correct , compilation is free from errors and warnings,builtable() function is working … |
| | i have a problem. i have a folder named jadu, there are various images . i want to show them in the a page. what i did its here [code=php]<? $path = "images"; $dir_handle = @opendir($path) or die("Unable to open $path"); echo "Directory Listing of $path<br/>"; while($file = readdir($dir_handle)) { …  |
| | Basically I'm trying to run a simulation of neurons and this is the code that gets run in the main loop of it. [code=c++] class Neuron { private: double v, u, a, b, c, d, current, du, dv; public: double x; vector<double> pre; int id; vector<int> fired; vector<int*> post; vector<double … |
| | Hi friends, I want to copy few cells of an excel sheet and paste special(picture) in ms-word. I want to develop a vb code code for this. Please help!... Regards, Dinil |
| | hi, there , i am coming up with a login page and i am having error when i run the programme. It says [B][ICODE]'Invalid attempt to read when no data is present'.[/ICODE][/B] [B][COLOR="Green"]Session("ses_uname") = rdr("FirstName") + " " + rdr("LastName")[/COLOR][/B] [ICODE]Imports System.Data.Sql Imports System.Data.SqlClient Imports System.Web Partial Class _Default Inherits … |
| | nw i hv been tryin a stuff tht m really nt sure if u guys understnd at once..bt sum1 hs to find a solution for it plzzzzzzzzzz... i need a code in C++ to do the following tasks...:- 1.) copy files from a folder 2.) save them in a different … |
| | Hi guys, i'm new here and new to c/c++ programming. could you guys guide me how to extract some character/number from a char string? Example: char = TAGNAME_C123_V45_S67_M89 i want to extract the numerical number next to the character. The TAGNAME and the number is varies. So my code should … |
| | Hello. I've been using a very helpful AJAX-based script called [URL="http://www.gayadesign.com/diy/ajaxtwits-load-tweets-on-your-website-with-ajax/"]AJAXTwits[/URL] to load multiple Twitter timelines for a sports team into a div. The nice thing about the script is that it (1) combines multiple timelines into one chronological timeline and (2) caches the xml for faster loading. Every so … |
| | Hello Everyone! This is my first actual post although I've been a member for almost a year. I'm writing a program that will create a random number between 1-1000 and ask the user to guess the random number. I also have the program display an error message to tell the … |
| | Hi. I have a Vector of Vectors that I need to rotate 90 degrees clockwise and 90 degrees counter-clockwise. I got it to rotate Clockwise, but whatever I try, I can't get it to rotate counter clock-wise. The 2D Vector is not always going to be a square. It will … |
| | Hi everyone, I've never had to do this before sooo, I need help. I have a table which maps managers to regular employees. So you could say that Manager A is mapped to 20 peeople and Manager B is mapped to 5, and so on. So the table looks like … |
 | I have posted this thread in the microsoft software forum as well but with no luck. If anyone can tell me how I can save a active excel file using a macro to save it in a folder using the current date as the file name. I hope that was … |
| | on line 53 it says menu is undeclared. but if i bought menu first then mcdonalds is undeclared. does anyone know how i can sort this out? ty [CODE] #include <iostream> using namespace std; double money = 50.00; void Mcdonalds() { cout << "Welcome\n"; cout << "How can i help … |
| | Hello everyone, My file has lines like: >9|102396631|genome..... CCACTTTCTCTCCGCGCTGGGTTGAACATGGTACATCAGACTCCCTGAATCTGTCAGATC TCTTGGTTGCTGTTGACAACTAAGACTTCGGAGCCTGGAG_GATTTGTTGAGGGGGAGCA GTTCTGGGTGTCCTCTGCTGTGACTGGGCTCCCGGCCTCTTGATAATGCGCAACAGCTGC GGTAGAACATCTCATTCCCAG >9|102362951|ENSRNOS.... I want to delete blank lines from this file please help me... Thanks |
 | Hello, everyone! I have a problem with memory free. Here is the necessary code to understand the problem: [CODE] void fillArray(char** referenceArray, FILE* grid) { //Chaîne qui va contenir une ligne du fichier. char* lineContent = malloc((width + 1) * sizeof(char)); //Pour contenir le "\0" int i, j; for (i … |
| | I have a form that I want to edit the values from the database. I am able to update all my values except for the radio boxes populated from my database. After my UPDATE command, the value being grabbed is the initial checked value from the database. [code=php]<?php $db_maritalstatus = … |
| | [code] i read that a method that is is using throws clause must be mentioned in the try and catch block.So when we use "throws IOException" in the following program why dont we use try and catch import java.io.*; class testthrows { public static void main(String args[]) //throws IOException { … |
| | Hi, I am trying to write some code to insert coordinates which are taken from the mouseClick position and then added to a 2D array. The user should click 6 positions on a panel and these positions should be stored in a 2D array. I hope you can help. Thank … |
| | How do I import a variable from another function in the same class [code=Python] class W(object): #my class def variable(self): #one of my functions f = 5 def printf(self): #what do i put here to import f from the function variable... #I'm currently working with python 3.1. #I know its … |
| | I'm toying around with taking variables that are passed from a form, into a new page, but only showing specific portions of the site if the variables come out to having a value. right now im using [CODE=php] if ($seasons=='true') { include('includes/seasons.php'); /* seasons show */ } else { include('includes/products.php'); … |
| | Hello everyone, I'm developing a website in ASP.NET. I have a Gridview and in it two LinkButtons: [I]Details [/I]and [I]Options[/I]. When the user clicks on Details, I have to show a Formview with the Details information. This part is already done. The part that is being difficult for me is, … |
| | I have a main form and I have menu's that open up within the form, but when I open a menu they open off the form. What do I need to do to make the forms open at the center of the main form? Thanks |
| | [code=c++] #define MIN_PASS_LENGTH 6 #define MAX_PASS_LENGTH 12 #define NUMBER_OF_PASSWORDS 3 #include<iostream.h> #include<stdlib.h> #include<time.h> #include<conio.h> #include<fstream.h> #include<string.h> //int i; //letters //int j; //numerals char rand_small_letter() { int nHigh = 122; int nLow = 97; int small_letter = ((rand()%(nHigh - nLow + 1)) + nLow); //values from 97 to 122 return (char)(small_letter); …  |
| | Hello~! ...again.. I got some help from you guys a while ago with this same app because it wouldn't run on winxp. It runs fine now, but my brother is still telling me he cant get it to work right...so rather than go through all the trouble of trouble shooting(he …  |
 | Hello.. Im trying to pass an integer to a function by adress because I want to change the value of the integer in the function. But it will not.. please help. Here is my function call: [code=c] insert_sorted(&VH, &L, n); [/code] Here is my function: [code=c] void insert_sorted(VirtualHeap *VH, LIST … |
 | hiii i have a field called DRIVE ACCESS under it user enters PATH DATE what i want is that when user click on + two new boxes open which allow him to enter the details for second DRIVE basically i want to enter text boxes dynamically using javascript.... any ideas …  |
| | Hi I want to store value from a row into a variable. I have used the following coding but it is not working properly. It is generating the following error: [B]Index was outside the bounds of the array.System.Data[/B] Please note that the table contains only one row. [code] objSqlConnection.ConnectionString = … |
| | Hi I use the reporting services to generate the report.I use query like "Select Distinct(ID) from Table1".In that query Its generate the number of ID ,So In report user able to several "ID" at one time,so I think if I can use combo box then user can select ID which … |
| | Hi. In my attempts to create an email client, netbean's GUI builder has made me very unhappy... so, I decided I'd rather code it by hand... not my best idea, but whatever. Now, I'm trying to nest a Vertical JSplitPane in a Horizontal JSplitPane, and I can't see the left … |
| | hello, i was just wondering as to what is the major difference between the Endswith() and Equals() method in .net (c#) ? I wrote the following code for string comparison n also for numerals by using Endswith method however even if i use Equals method i get the same output … |
| | Hi I am developing a windows application. For your infomation FRONT END : C# (VISUAL STUDIO 2008) BACKEND : SQL SERVER 2008 In a single form I have an option for add and remove books. Two different buttons are used(Add and Remove Books). When I click on Add button the … |
| | [code]Excel.Application ExcelApp = new Excel.ApplicationClass(); ExcelApp.Visible = false; String WorkbookPath = filename; Excel.Workbook ExcelWorkbook = ExcelApp.Workbooks.Open(WorkbookPath, 0, false, 5, "", "", false, Excel.XlPlatform.xlWindows, "", true, false, 0, true, false, false); Excel.Worksheet Sheet = (Excel.Worksheet)ExcelWorkbook.Sheets[1]; DataTable newTable = new DataTable(); string strConn = "Provider=Microsoft.Jet.OLEDB.4.0;Data Source=" + filename + ";Extended Properties= Excel … |
| | i need to how to give codings to buttons that are present in confirm dialog box. For Example if there are two buttons as "YES" and "NO" and if i click "YES" then the program should close. If i click no then th dialog box should return to the program. …  |
| | Hi All, I am trying to echo the held text in the "Title" field where the id has a fixed value of 1, but i am getting the following error: supplied argument is not a valid MySQL result resource in C:\wamp\www\index.php on line 46 your help would be greatly appreciated. … |
| | I m trying to execute the sdo_migrate.to_current method like this : [CODE]execute sdo_migrate.to_current('tablename');[/CODE] but i keep getting invalid sql error, and i dont understand why. Please help |
The End.