64,152 Solved Topics
Remove Filter  | |
| | [code=c#] using System; using System.Collections.Generic; using System.Text; namespace selectionsort { class List { public int[] arr = new int[10]; public int[] arr1 = new int[10]; public int n,h1; public void read() { Console.WriteLine("array size should be less than or equal to 10"); Console.Write("enter the array size "); n = Convert.ToInt32(Console.ReadLine()); …  |
| | I often hear the saying that iostream is inefficient in terms of performance, and it is better to use printf family if type-safe is not concern. But as far as I know, the static type checking (is this thing people call the 'type-safe' do?) is done in the compilation, and …  |
| | Hello, I happen to be a novice in the realm of C++, and I'm currently confused due to this error when trying to run my application: "Assertion Failed. Expression 'stream != NULL' ". I've looked it up, and nothing that comes up can answer why it gives me said error. … |
 | Has anyone tried to write [URL="http://support.microsoft.com/kb/307398"]this tutorial [/URL]using VC++ 2008 Express? The article claims to be written with VC++ 2005. But I thought 2005 and 2008 used compatible versions of CLR language. I'm getting all kinds of compiler errors -- for example [icode]String* str;[/icode] instead of using [icode]String^ str;[/icode] and … |
| | I have been trying to build a Java program to prompt the user to enter the radius of a circle and the diameter, circumference, and area will be output through a "System.out.printf" statement. I can get the program to prompt for the radius and it will display the diameter, but … |
| | I need to show a message as a label whenever user selecct To year less than from year. I have created a label "lblYrChk" --doesn't work . what i am doing wrong. Pl. help. [code=asp.net] <asp:ObjectDataSource ID="Srcfmyr" runat="server" OldValuesParameterFormatString="original_{0}" SelectMethod="GetData" TypeName="HITS.App_code.stateTableAdapters.SOURCE_YEAR_VWTableAdapter"> <SelectParameters> <asp:ControlParameter ControlID="RBl1" Name="myType" PropertyName="SelectedValue" Type="String" DefaultValue="G" /> </SelectParameters> … |
| | Dear Sir, I have got a serious problem to understanding of the answer. The question is: Create the first half of a game of rock, paper, scissors. Ask the user for R,P or S. Get the computer to generate 0,1 or 2. Now convert the computer's number to R, P …  |
| | Hello In my asp page I successfully extracted records from my database. The records are written in Hebrew. I used <% @ codepage=65001 %> and <% Response.Charset= "utf-8" and the display worked ok inside HTML. Inside my asp code i joined all the values to one string using "x = …  |
| | I'm stumped right now, I cannot figure out how to code something to get information from another form. This is what I'm trying to do: [code=VB] Private Sub Button1_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles Button1.Click If TextBox1.Text = "01" Then 'TextBox1 is in form 2. PictureBox1.Image = …  |
| | Hi all, it's my first time in this forum, I hope you can help. I've searched the web for a long time, couldn't find help, yet. I have a listview that displays a list of PDF files. When the user clicks on a row (in the "selectedIndexChanged" event), I display … |
| | So I'd like to get rid of the insecure warning I get in IE6-8 whenever I'm on an HTTPS page like this one: [url]https://checkout.netsuite.com/s.nl/c.659197/n.2/sc.37/.f?login=T&reset=T[/url] I can't tell what's not loading, but I'm assuming the two errors I got in Companion.JS v0.5 in IE7 are clues: 1) 'jQuery' is undefined (line … |
| | Dear mates, I am am frustrated and bored to learn how to get or calculate coordinates data for Java Graphic API. for ex the GeneralPath 's function curveTo() takes 6 parameters namely x1,y2,x2,y2,x3,y3.I put some random coordinates data into these function and got a crap drawing. :( I want to … |
 | I am having a problem on how to count numbers inside text area. . . example: In my text area I have 10 numbers. 12, 06, 31, 22, 53, 28, 96, 71, 10, 47 the the program should count how many 0,1,2,3,4....9 excluding the comma. I don't know how to … |
| | Hello I have a script which uses CURL to create a database using CPANEL. But it is giving the following error message: [code] Warning: curl_setopt() [function.curl-setopt]: CURLOPT_FOLLOWLOCATION cannot be activated when in safe_mode or an open_basedir is set in /home/aquarius/public_html/createdb/includes/ecurl.class.php on line 35 [/code] It is not an issue with …  |
| | I'm using this code to colour individual items in a listbox, but the problem i am having is it colours all previous items with the new colour. How can i colour each induvidual item without this happening? Here is the code I'm using: (_colour is a global int) [code=c#]private void … |
| | Hie guys.How do you write a vb function that returns the frequency of each word that appears in a given text file.e.g.if the word "the" appears twice,it would return "The word 'the' appears 2 times".This has to be done until the end of the file without searching for a particular … |
| | here is the code.... [CODE] #include<stdio.h> int main() { int *k; *k=10; printf("%d %d",k,*k); return 0; } [/CODE] it compile perfectly. but on executing it is giving segmentation fault. where is the problem?  |
| | I have to open a file whose name i am constructing by concatenating various inputs from the user. If I write: [code] string s = "filename.csv"; ofstream fout; fout.open(s,ios::app); [/code] it gives error for using s in fout.open(). It says it is a wrong form. I need to use a … |
| | Hi All, I want to know how to bind data to DataGridView Control. I have seen examples on google nd other sites. but all examples use DataBind() while in my program, it shows DataBindings() in intellisense. I cant find out how to do this. I have to bind data from …  |
| | Hello, I'm currently working on a little soft to plot some data from CSV files. I've got two problems. The first one is on CSV opening in procFile method. When I try to open a file with a path which own "é" characters for example, it raises an error. I've … |
| | Hi. I'm new to java programming. I have some questions: 1) Does every java source code's [B]class name[/B] (the name after the [I]class[/I] keyword, e.g. [I]class[/I] [B][I]Hello[/I][/B]) has to be started with an uppercase character? 2) Does the java source code's [B]file name[/B] (e.g. [I][B]Hello[/B][/I].java) has to be [U]exactly[/U] the … |
| | I have a query that retrieves records from a table: [CODE] <?php $query = "select * FROM Ev_AvVolunteers where id_Event='$id_Event' ORDER BY Name"; $results = mysql_query($query) or die("Error performing query"); ?> [/CODE] It is sorting by Name now BUT I want a different sort. There is another field called "Instrument" … |
| | Hello, I am trying to compile a set of files. I got fustrated to the point of taking the actually instructor files from the book and compiled them. I am using AndLinux and the g++ compile to run my programs. If anyone is familiar with the book "Accelerated C++" I … |
| | Hi all i have checkboxlist populated from a table in database.now how can i store only checked items to database. |
 | Here is my final product: [code] #include <iostream> #include <fstream> #include <iomanip> #include <string> using namespace std; void printGrade(int oneScore, float average); void printTable(int scores[], int id[], int count); float computeAverage(int scores[], int count); const int MAX_SIZE = 21; void readStudentData(ifstream &rss, int scores[], int id[], int &count, bool &tooMany) … |
| | Hello again, My assignment is to calculate a 10% bonus based on sales figures. I have to use a main() function, obviously, and 3 void functions, getSales(), calcBonus(), and displayBonus(). I'm pretty sure I have the functions coded correctly, I'm just having some issues getting them to actually run correctly …  |
| | I've searched for days on how to find the correct way to convert a string to a float and then double the user entry. Any help would be appreciated. Thanks. #include <iostream> #include <cstdlib> using namespace std; bool FloatInput(char []); void main() { float floatValue; char buffer[100]; bool validInput; do … |
| | Hi, I would like to use textbox to accept date in VB 6 instead of using dtpicker. The text box should contain oblique sign like ( [B] / / [/B] ) to enter dd/MM/YYYY type date during form load. I tried to use Microsoft Mask Edit control also but it … |
| | hi, i'm creating application using visual basic 2008 express. It's great acctually, but I'm having problem creating report with it. Can anyone suggest reporting tools that can be used with VB 2008 express? I tried microsoft report viewer 2008, and it seems that vb 2008 express doesn't support report design … |
| | Hi, I'm working on a program to convert Celsius to Fahrenheit, but I have a problem when I run a check to make sure that input is not a letter. My problem is that if the user inputs a 0 it catches it with the [code=C++] if(num == 0) { … |
| | I have a combo box which is in set to be a drop down list. How do I change the label text based on which ID is selected in the combo box. How do I make the label text change to the corresponding row as the ID? Thanks |
| | hi.. well i have a gridview on a page and when the user selects the gridview row then that gridview row should be redirected to a new page. this new page has another gridview which i need to populate with the selected gridview from previous page. can somebody help me … |
| | Hello, I had to creat the following code that displays a table depending on the number te user entered. [code] int main() { int n = 0; const int base = 4; std::cout << "Enter max: "; std::cin >> n; std::cout << " "; for(int i = 1; i<= n; …  |
| | Hi, I'm looking for some help with this short program I am writing... I'm trying to make the sure that the user enters a number when it asks for the temperature in Celsius, and when the user enters a number it works. However if a letter is entered it all … |
| | hii everybody, I have a weird problem with a program for solving sudoku puzzles. I am representing the puzzle as a list of lists of lists containing all the possibillities for a single square and my problem is that when I try to remove a single appearance of a number … |
| | Hello all, I'm trying to approximate a sine wave using bezier curves (for rendering speed over drawing many straight lines). I'm trying to follow the non-C# code specified down the page at: [url]http://commons.wikimedia.org/wiki/File:Harmonic_partials_on_strings.svg[/url] [code=C#] // Produces a sine path as flat point array {PT, PT[3], PT[3], ...} private static List<PointF> … |
| | Hello! I'm trying to make a command line program that converts Celsius to Fahrenheit, and then asks if you would like to convert another number. This is the code I have (below) however when it gets to the point of asking if you would like to convert another number, no … |
| | hi. I'm a newbie in shell scripting as well as the *nix OS. I just wanna ask about the symbol [B]#![/B] that I saw in many shell script examples. For instance, [ICODE][B]#![/B]/bin/bash[/ICODE]. What does the [B]#![/B] symbol means? What's the meaning of [B]$1[/B], [B]$2[/B], [B]$3[/B] symbols? and what does the …  |
| | Hello everyone, my file1.txt have sequences as given below: >1|62798264|[COLOR="Red"]rs8174605[/COLOR]|T/C||dbSNP|T/C AAGAGGAGAAAGCAAAGTTGCAAAAGGTGAAAGAGAAAGAAGAGCTAGAGAAGGGCAGGA AGGAGCAGAGTAAGCAGAGGGAGCCTCAGAAGAGACCGGA_GAGGAGGTGTTGGTGCTCA >1|100159271|ENSRNOSNP145|T/A||ENSEMBL:celera|T/A TCTTATAATTAGTCATTGTGATAACTGCTACAAACAAAGTCACAGGATCTTGTGAGAGAA >1|19033646|[COLOR="Red"]rs8173848[/COLOR]|C/T||dbSNP|C/T TTGCAAAAAAAAAAAAAAAAAAAAAAAGCCAGAATCCAGCATAAGTCAAGGAAATCCACT >1|149643853|[COLOR="Red"]rs8173465[/COLOR]|G/T||dbSNP|G/T AACAGAGACAGCTGTGATGTACCCCATGAGCTGGAAAGAGCAGCCCAGCGGTGTCCCAGC >1|101456015|ENSRNOSNP1318|G/C||ENSEMBL:celera|G/C AACTCTTAGAAGTTAGAACCTGGGGTGGAGAGATGGCTTGGTGGTTGAGAGCATTGACTG I want result file which do not have sequences with "rs"number e.g rs8177678, these are colored red in each sequence. so my output file should have 2 sequences: >1|100159271|ENSRNOSNP145|T/A||ENSEMBL:celera|T/A TCTTATAATTAGTCATTGTGATAACTGCTACAAACAAAGTCACAGGATCTTGTGAGAGAA … |
| | Is there a way to use the NumericUpDown control without a maximum or minimum value? |
| | I know how to make random numbers. and How to make random numbers in a specific range. BUT!!! How can you display 'x' random numbers in a given range and make it so the output display lists the numbers in groups a 'y'. For example: I want to display 25 … |
| | Hi, I have my own widgets ( simple one) and want to put them in one file and call them from second file. This is like easygui but with pyqt4. My problem - when I call my widget from second file nothing happens. This is file with widgets (example). [code …  |
| | I am trying to search for something in the database. However, this error keeps popping up. I was wondering if anyone could help me. Thanks [code=php]<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN" "http://www.w3.org/TR/html4/loose.dtd"> <html> <head> <title>Untitled Document</title> <meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1"> </head> <body> <? $host = '127.0.0.1'; $database = 'lab11'; … |
| | Dear Sir, Could you tell me how can I do this question? Write a program that will readin three numbers nd output a message indicating whether or not the numbers were entered in ascending numerical order. (Equal entries are regarded as being in order, e.g. 4 4 5 is OK). … |
| | hi, just a quick question can somebody please tell me how to restrict the output of the code below to 2 decimal places. [code]VolumeCalc.Caption := FloatToStr(StrToFloat(EngineSizeVal.Text) / 2 / StrToFloat(CylNumVal.Text));[/code] thx for the help. |
| | hai friends, I dont know how to create database dynamically in vb.net.(if a button is clicked 4 databases in access or sql has to be created).similarly by clicking the delete button the specified database should be deleted.can you help me out with the coding. |
| | i want to create a simple form which stores date in to a ms access db so i created a form register.html and action user_register.jsp i also created a ms aceess db when i fill the form the data is passed to the Auction.mdb but the server shows error HTTP … |
| | I developed a jsp page.. and i dont want any one to access the page just by copying he URL what to do.??? |
| | Hi All, it's me again :) How can I attach MySQL to my ASP.Net application? I want to create user table in MySQL and then use the login controls in my application to give the user access and different roles? Thanks in advance! Donish |
| | hi! I'm trying to get the following C++ class (contained in a DLL): [code] __declspec(dllexport) class ThreadManager { public: __declspec(dllexport) static UINT32 setThreadPriority(UINT32 tPriority); __declspec(dllexport) static UINT32 setPriorityClass(UINT32 pClass); __declspec(dllexport) static UINT32 setProcessorMask(UINT32 pAffinity); __declspec(dllexport) static UINT32 changeMATLABSeed(UINT32 inputSeed); static BOOL setHandles(HANDLE* thread, HANDLE* process); __declspec(dllexport) static BOOL testFun(UINT32 testInt); …  |
The End.