15,408 Topics
 | |
 | I have addressed this problem sometime ago; I have either misplaced, misunderstood, or never received a response to this issue so therefore I am again attempting to deal with a Python issue: I am towards the end of a build, and I am dealing with button commands, something that was …  |
| | Hello Everyone, I am an intermediate developer in programming languages. I have developed some python script and some java applications. In my project, I need to integrate the python script with a java application to put all the tools in a single pipeline to function as a continuous workflow. This …  |
| | I need a way to get all the possible combonations of two lists. I looked into map(), but it only loops through the first array. I tried to do a map function inside a map function, but I couldnt figure out how. Heres an example: [CODE]>>> a=[1,2] >>> b=[3,4] >>> … |
| | Dear help I am struggling to figure out why the following sorting algorithm doesn't work. Please help if you can. :) >> #myList is a list of arbitrary length for i in range (len(myList)): for j in range (i, len(myList) - 1): if myList[i] < myList[j]: myList[i], myList[j] = myList[j], … |
| | I am working with a keyloger procedure to capture user inputs even mouse has no focus on my app windows. I make it work using that code, the problem is that [CODE] event = handle.read(6)[/CODE] only reports clicks when buffer is full. Its not working ok because there is a … |
| | [CODE] # PURPOSE: to calculate the sum of the first (n) counting numbers # # INPUT(S): the number (n) which will be the last number added to the sum # # OUTPUT(S): the sum of the first (n) counting numbers # # EXAMPLES: input: 4 ; output: 10 # input: …  |
| | I new to Python and I'm trying to make this script work, I made this in php, but I'd like to know how to do it in python... I'm trying to encode a file with base64 and then decode and write the binary data to a file. [CODE=Python]import base64 binaryfile …  |
 | Hi, all. Just been asked to help design a motion rig for a flight sim for a charitable museum in the UK. I have built robotic and control systems for a few years now mainly with PLC's some python and PICs. they are running Microsoft FS2004, and there is a … |
| | Hi, I am new to python but I want to use it over perl because I think it is a better overall approach to programming. This is a bioinformatics problem. I have four identically formatted tab delimeted files that have genomic variation data. Each line looks like this. chr1 11828655 … |
| | Hi, I have a dictionary storing many things... I would like to delete entries which have key of len < 3. But after I do the del statement, there are still lots of entries with len < 3, what happens? [CODE]for w in fdict.keys()[:]: if w.strip() in banset or len(w.strip()) … |
| | How to start a new thread?Sorry am a new bee here.  |
| | Please help I'm having trouble getting my program to return any answer other than "You Lose!". Where is my mistake? Thanks in advance for any help. [code] print "Let's Play Rock, Paper, Scissors!!" print "Rock beats scissors, paper beats rock, and scissors beats rock and paper! Have fun!" import random …  |
| | hi guys can anyone explain to me this code. i dont really get this. thanks a lot. def readFile(name = ""): try: assert (name != "") , "The file name is not given!!" except AssertionError: print "file name is not given" else: try: f = open(name, 'r') except: print 'File … |
| | How to fill array with any no like using zeros and ones. i'm new to python and i can't find the answer.... |
| | Write a python function to convert a numeric input argument to a string output based on the following rules: >=10: A, 9:B, 8:C, 7:D, 6:E, <=5: F I came up with this, but it does not work at all table = {'A': 10, 'B': 9, 'C': 8, 'D': 7, 'E': … |
| | hello there Iam using python 2.5.4 pyserial 2.4 pywin32-214 on windows 7 i hav a small test script written to query a serial device (arduino) and get back reply appropriately ////file: test.py import serial print 'hi' ser=serial.Serial(port='\\.\COM2', baudrate=9600) ser.close() ser.open() ser.write('1') ser.readline() ser.readline() ser.close() the device waits for '1' through …  |
| | Write a Python program that creates a dictionary of son-father pairs-you can make the pairs with fictional names for fun. Your program should populate this dictionary with the son-father pairs you made up. Your program should present the user a menu with two options. The following is an example: Father …  |
| | test = 4 #start of def def change(): test = 5 #end change() print test Why doesn't it print 5? Can anyone explain this to me? Btw, test = 5 is indented, the forum won't let me indent for some reason |
| | Hi everyone I was wondering if I could get some help on environment variables. I am executing a cgi file from a C file with execv(). The cgi is able to generate the html template correctly. However I am unable to grab the "REQUEST_METHOD" since it always returns NULL. Can … |
| | i need to create a program that translates an english phrase to a spanish phrase. i have a text file with english words and their spanish meaning. i am unsure how to start this as i am quite new to phyton. ignore the grammar, i want to translate the phrase …  |
| | here I have code in python and now I want to transfer it in Java. import logging import urllib import re from waveapi import events from waveapi import model from waveapi import robot from waveapi import document from django.utils import simplejson from google.appengine.api import urlfetch def OnDocChanged(properties, context): #Get Contents … |
| | I would like to find and replace a string in a file. I know how to do this, but I can only do it for all instances. Is there a way to do it for just the first instance of the string in the file? import fileinput for line in … |
| | [code] Traceback (most recent call last): File "C:/Python31/sample.py", line 10, in <module> calendar.prcal(year) AttributeError: 'module' object has no attribute 'prcal' [/code] Hello, I just started learning Python with this fantastic site. Unfortunatly I get this when i try to execute the following code [code] import calendar print( "Show a given … |
| | hello, I have faced a problem that is almost as same as the problem below: ((((If I try to define a timer in an ogl.BitmapShape, like this: class T6963_device (ogl.BitmapShape): def __init__(self): ogl.BitmapShapeinit__ (self) self.t1 = wx.Timer (self) I get this error Traceback (most recent call last): File "D:\data_to_test\smtest2.py", line … |
 | Hi everybody, I'm trying to install python 3 from source in my new Mandriva 2010. I have read a lot of posts in this website, but none of the instructions has worked for me. The code compiles and all, but it doesn't install tkinter. I know that tcl/tk are installed … |
| | Hello, i would like to make program in python which reads the lines from an input file, which looks like this: Bob 10 20 30 John 15 15 Kate 20 and the program sums the numbers for each person and writes into an output file which should look like this: … |
 | Hello friends, I have created simple rss reader class, but the class contains many loops and didn't work correctly and if anyone wants to help me with code, example, tutorial etc... I would be very grateful. The code of the class you can see on the following link: [url]http://pastebin.com/F7zQdhAW[/url] Thanks... |
| | Hi I need some help with sizers. I just can not get my head around it and i cant find much on the net about what i am trying to achieve. I am not even sure if i need a grid sizer or two box sizers. This is what i … |
| | Dear all, My window layout looks like this.. [img]http://i41.tinypic.com/hu27ax.jpg[/img] First, the dialog box that consists of listbox would appear to ask for user input. After the user input has been given, It will display in the next windows.. I have been trying to intergate the two coding together. However I … |
| | I'm using python for a project and was curious if anyone knew whether it was possible to open up jpg files in a GraphWin window. Also, the image software I'm using with it is PIL, if that helps. |
| | I'm new to here.so i posted it on the code thread pls go through it and help me [url]http://www.daniweb.com/code/snippet271890.html[/url] |
| | [code]#Blast workbench using biopython from Bio.Blast import NCBIWWW ##result_handle = NCBIWWW.qblast("blastn", "nr", "8332116") fasta_string = "AATTCAGTGGCAAAAAAAAAACTCAAATTTTAGGGAAGGCCCTAATATTATCAAATAATTAGAGGGGGGG" result_handle = NCBIWWW.qblast("blastn", "nt", fasta_string) save_file = open("my_blast.xml", "w") save_file.write(result_handle.read()) save_file.close() result_handle.close() result_handle = open("my_blast.xml") from Bio.Blast import NCBIXML for record in NCBIXML.parse(open("my_blast.xml")) : #We want to ignore any queries with no search results: … |
 | Is python web programming anything like php? Is there simple examples like submitting a form to perform a calculator functions etc? |
| | I want to remove all the 1's from the sublists so l becomes [[2], [2], [2]] but have trouble keeping track of indices. Can someone help out? [CODE]l = [[1, 2, 1],[1, 1, 2],[2, 1, 1]] i = 0 for element in l: while i < len(element): if element[i] == … |
 | Hello. I need some help. I have a function [icode]my_function(a, b, c, d)[/icode] which takes string parameters and output them in different combinations. It works well in IDLE, but I would like to output the result into a file. Such code [code=python]file = open("out_file.txt", 'w') file.write(my_function(a, b, c, d)) [/code] … |
| | I'm a bio informatics student who is leaning programming.With the help of this site and other blogs I made this one so far.I need to create a interface which give a text box to enter sequence and a start button and a window that display results.I went through Wx tutorials … |
| | Just a quick one- I'm writing code that asks the user for a filename and checks that it exists. If it does it has to print the file's contents, if not print a message. [CODE]import os fileName = raw_input("Enter the name of the file: ") if os.path.exists(fileName) == True: fileName.read() … |
| | I'm trying to get a SQLite3 DB to populate a wx.ListCrtl. I can get it to print to stdout/stderr without any problem. I just can't seem to figure out how to display the data in the DataWindow/DataList? I'm still learning programing/python so any advice would be appreciated. After two days …  |
| | I have this code: [CODE]class Member: def __init__(self, name, typeOM, fee, yearJoin): self.name = name self.typeOM = typeOM self.fee = float(fee) self.yearJoin = yearJoin # Reader Methods def getName(self): return self.name def getTypeOM(self): return self.typeOM def getFee(self): return self.fee def getYearJoin(self): return self.yearJoin def getMemberTypeString(self): if self.typeOM == 'P' or … |
| | Hi, I have serial data that can come in at irregular intervals from a hand held barcode scanner. The scanner continuously looks for a barcode (no button or trigger is ever pressed) and when the scanner captures a valid barcode it sends the code to the PC over serial. What … |
| | I'm trying to code the game of Minesweeper. I haven't put in graphics just yet, only text labels on the buttons. Here is my create_widgets method: [code] def create_widgets(self): #Create the grid. self.square = [] self.isAMine = [] for i in range(self.y): row = [] mineRow = [] for j … |
| | Hi all, I am trying to open an excel file which is in the same folder as my python script. The script is able to open the file first time, & after that it just throws the following exception: pywintypes.com_error: (-2147352567, 'Exception occurred.', (0, u'Microsoft Office Excel', u"'test .xls' could … |
| | Hello all and thanks in advance for any help you can provide. I'm new to programming in Python and am looking to put todays date parameter passed into a URL string...how would I go about accomplishing this. This is some code I've sort of been messing around with: [start code] … |
| | [CODE] def dotask(): print "Task done..." def returnvalue(): return "Awesome" cmd = raw_input("Your command: ") eval(cmd + "()") [/CODE] I know that you can't use eval to assign a value to a variable. but is it the best way to have user input be performing a function? For example: I … |
| | Greetings, I just want to know how to split a string using values of dictionary: dic = {'': '000', ' ': '011', 'e': '1111', 'g': '10', 'h': '010', 'o': '00', 'p': '1101', 's': '1110', 'r': '1100'} word = '1000011100001110001101010111111001110000' for items in dic.values(): [INDENT]word.split(items)[/INDENT] .... and when i do this … |
| | Hi everyone, I am getting a error when using Xampp with mod_python addon and another python script 1. First I entered a string in a html form and passed it to pyform.py 2.Now in pyform.py, I imported the entire simpledb.py module. 3.Simpledb.py module fetches data from mysql server. Everything till … |
| | I absolutely can't figure this problem out, can anyone please help? Write a program that asks for a phrase and then calculates and displays the number of vowels in the phrase, twice. The first time, your program should calculate the number of vowels in the phrase using a for loop. … |
| | Here is 2 classes: [CODE] class Test(object): def __init__(self, var1=123): self.var1 = var1 class Test2(Test): # ... [/CODE] As you can see, Test2 is an instance of Test, which has var1. var1's default value is 123. How can I change the var1 in Test2 without __init__ again? Or better yet, … |
| | A demo of the Tkinter listbox widget that shows you how to create the listbox, make it scrollable, position it within a grid, load it with data from a file, select a line of data with the mouse and display it. Also, sort the lines, add a line, delete a …  |
 | I've realized that it would be very helpful to me to SET the mouse cursor to a particular location. Having done the usual internet searches, I can't seem to find anything on how to do it. Any ideas? (So I'm still set on converting to wx, but the project I've … |
The End.