Software Development Forum

Hello all, I am trying to read value from a XML message fragment using C# and I am unable to load and read the document mainly because I don't enough experience working with xml data. I don't have the raw xml document on hard drive, so it is generated from …

So I'm working on this class, which is basically to wrap a char into 8bools, and it works so far, however I'm running into a problem, in the dedication of values, since I'm to use the overloaded array operator, as well as the overloaded assignment operator, at once, however I …

I'm a novice at VB.NET and I'm having a problem with the compiled versions of my applications. If I take the .exe file (it's real small, like 40KB) from the BIN/DEBUG directory, it runs fine on most computers (I've tried it on 5), including Windows 7, Vista and XP. When …

I am a adult returning student in Java and would really benefit from having someone work with me on exercises to further my understanding of the material. Anyone interested in helping would be greatly appreciated.

Restarting C++ class after lengthy break, seems I've forgotten a lot. I can't seem to get a cout to indicate that a file record has been read. I created a text file of just one record to keep it simple: an SS number, first and last names, and five exam …

I am trying to do this C++ homework, my second one, i am very new to this and have no idea what is going on i would appreciate any help. thank you. below is the homework problem and what i have so far. i know that i need to create …

Hello, I have a little problem. My program (LH-ABC 3.2.0) works well in Windows XP and Vista. But in windows seven programa closed, but process keep going :S What can be problem? Maybe one thread not closed? But this problem is exclusive in windows seven. Source of my program in …

Does anyone know if there are any issues in using the basic ODBC Api for database access on 64 bit Windows Vista/7 systems? This has been my preferred database access technology for a long time, and I'd prefer not moving to ADO or something else if I don't have to. …

So I am trying to compile this program, and I know that the only problem with my code has to do with the "while" section of the do while loop, either that or something to do with those variables. I declared the variable "repeat" as a char, and prompted the …

I have been reading books trying to learn .net on my own. I am working on an exercise that asks me to create a 1MB file. what i have below does work, but it seems to me there would be a more efficeient way. It seems like what i am …

I am learning Python now. It is too complicated. I started the file that i did but it crashed. Can you show me how to do it? Write a Python program to convert a given weight from kg to pound and to gal and to liter. 1kg=0.2642gal=2.205lb 1gal = 3.785liter …

hi all. i need to work with CvFitLine , but i can't find any examples of what it does. basically i need to take a set of points (lets' say 3) , draw a line between them, and than i need for every point sum the distance of the point …

So I'm working with OpenGL, and DevIL to load some JPEG into my program, and I've had some trouble, I've isolated the program in a simple sample program (uploaded), the program is, that when I load the standard file, that came with the guide ("Geeks3D.jpg") it loades instantly and runs …

Hello Python community, I've just finished building an app with Python and I'd like to share my experiences and get some feedback. This was from scratch (no code templates) all the way to compile and distribution on a Windows environment. Now all my colleagues at work are using the app …

I want to select 5 points set from n given points one by one exhaustively. In other words i want to do nC5 in c++ but not getting a simple way to do it. Please tell me any solution.

Hi folks, I am a newbie to python, and I would be grateful if someone could point out the mistake in my program. Basically, I have a huge text file similar to the format below: AAAAAGACTCGAGTGCGCGGA 0 AAAAAGATAAGCTAATTAAGCTACTGG 0 AAAAAGATAAGCTAATTAAGCTACTGGGTT 1 AAAAAGGGGGCTCACAGGGGAGGGGTAT 1 AAAAAGGTCGCCTGACGGCTGC 0 The text is nothing but …

hi, can somebody please tell me what would be the problem that it couldn't open the file? i compiled it in dev c++ and it gives me no error. the file 512.dat is in the same directory. [CODE]#include<iostream> #include<fstream> #include<stdlib.h> #include<stdio.h> const int sc = 768; int main() { int …

Hello, [code= c] main() { int i=4,j=7; j = j || i++ && printf("YOU CAN"); printf("%d %d", i, j); } [/code] The answer to this question is 4 1 and the reasoning is that the compiler finds j to be true and hence does not need to check the remaining …

I was wondering if someone can help me with how to convert my code so that it converts the cents to dollars and also round to the nearest cent: [CODE]public class Subscription { private int price; private int length; public Subscription(int p, int n) { price = p; length = …

I'm currently taking Java I and I have to write a program that reads 5 integers and determines and prints the largest and smallest numbers without using an array. I have to only use the if statements. I can't figure out how to make the if statement apply to 5 …

hey everyone, so im trying hard to get this assignment done by tomorrow but after sucessfully compiling, I am now getting linker errors. I have to use Vi for this assignment but never the less here are my linker errors: assign5.o: In function `main': assign5.cpp:(.text+0x1026): undefined reference to `Print(cStudent (&) …

Hey everyone, I am writing a program for my c++ class to take student records and organize them according to the students last name. All data is stored to a class and I have created an array of class objects(its part of the assignment). I am using Vi to compile …

It seems even if I place #define _CRT_SECURE_NO_WARNINGS at the top of my C++ source files, if the warning level is set to 3 or 4 I still get all the warnings. Is this the way it is supposed to be? I like to have my warning levels set fairly …

I got this from the python docuemtation. date2 = date1 + timedelta --->date2 is timedelta.days days removed from date1. (1) date2 = date1 - timedelta---> Computes date2 such that date2 + timedelta == date1. (2) timedelta is an object representing a time [I]difference[/I] and a date object represent a certain …

I need help with running two function at the same time . MultiThreading? [CODE]void Function1(int n) { while(n<10) { n++; } } [/CODE] [CODE]void Function2(int n) { while(n<20) { n++; } }[/CODE] If these are the 2 functions,can someone tell me how I can start the 2 together [B][U]from int …

Hey everyone, Browsed through the forums and a C++ book, but can't find what I'm doing wrong. 1)Goal is to pass colors array to a function that picks a color set from 19 options and modifies red, green, and blue to be used in an allegro function. Each color set …

hello please help me on this i make a simple program that inputs the first name and family name and age, and this will display to the table ...can you help me how to delete the save data on my JTable the one that i inputed ...thanks in advance hoping …

I'm having a bit of trouble getting string input while i'm in a function. I was wondering how I could input a really long string (about the size of a paragraph). cin >> entryA seems to work, but only with 1 word. Any more and it starts looping getline(cin, entryA); …

hello can you help me please... i have a button print and i dont know how to make the code that will print all my data in my database....please help me how to make this print code ..hoping for your positive responds.

Hello! I'm beginning learning C++ and I was wondering, does Visual Studio 6.0 support all of the language features or is it too outdated now? If so are there any free compilers/linkers that I can use for windows programming? I'm also worried about the windows API headers being outdated as …

I want the extract the two values(113.654321 and 114.654321) from the CString CString sValue = "113.123456 114.654321"; I tried to use the TrimLeft function of the CString Class, which is sNewValue1=svalue.TrimLeft(_T(" ")) and sNewValue2=sValue.TrimRight(_T(" ")) but I cannot get the expected value. Can anyone help? Thanks in advance!

Hello C experts, [code=c] main() { int i=0; int x; fork(); fork(); fork(); i++; x=&i; printf("%d %x\n",i,x); } [/code] Each child process gets its own copy of i , but why does x not print different address ?

Hello all! I thought I was finally getting good at this "Java" thing, and then someone suggests to me that I use a singleton and factory class. I'd never heard of these before so I set off googling it. Now, I get the gist of singleton and factory classes, but …

hey guys! so I need to create a matrix 6x6 and then fill it with random numbers from 0 to 3.... and I need to leave the diagonal of the matrix with 0s... The rows are supposed to be soccer teams so if row 1 wins row 2... the program …

Can we use any C# or VB.NET controls or components in VB 6.0? or Is there any place where we can get free controls or components for VB 6.0?

Hey all! I have this assignment for my school project to create a simple address book using classes that do the routine stuff like adding a contact, searching it, modifying it, deleting it... Here is the code but it won't run properly. I tried but couldn't figure it out. It'd …

Hi All, Im new to the forum so not sure where to post my question, any help would be greatly appreciated. I have written a program in Delphi 2007 using MS SQL connection, My program runs fine on the development system but as soon as I put it on a …

I have been searching my texts, the web, and DaniWeb for information about how to share data between compiled C++ executables. I've been studying extern variables and named pipes without success. A typical program calls another program like this: float Pi = 3.14; system("AdjustSeaLevel.exe Pi 5.4 11.2 c f g"); …

kindly please tell me how to connect from java to ms access, sql,oracle and so etc . with example

how can I check the difference between two dates using the datetime modules? (or any other module that would do the same thing). I want to read a date from a file (which was written in the same format as the datetime module uses) and then calculate the difference in …

I need to write an overloaded function for a pascal triangle. I have to include another function that fits n!/((n-r)!r!), I can't figure it out. Help please! This is what I have so far: [code] #include "stdafx.h" #include <iostream> using namespace std; int my_fib(int,int); int x,y,j; int main() { x=0; …

Greetings, I am suffering a loss of sanity at the hands of this issue. I think i have something worked out, however, could someone shed some light and keep me sane? [B][U]Problem Description[/U][/B] It would be of interest to others if you could write a program that would allow other …

can you please help me how to insert a backrond picture in vb6.

im am trying to find the best method to use for the following: I have an applicaiton that is going to be loaded 24/7 running in the background. what is the most efficient way to display the current date on the top of the form so that it changes on …

Hello to all my fellow IT people! I have two questions! I would like to start learning how to program! Is Java a good beginners language to start with and if it is not what is a good language? My second question is if Java is a good language then …

I am trying to update a sequence of records where the field WebSvc = No Here is the code [code] cn.Open() da = New SqlDataAdapter("SELECT * FROM dbo.DurexBOL", cn) cmdBuilder = New SqlCommandBuilder(da) da.Fill(ds, "DurexBOL") Do While ds.Tables("DurexBOL").Select("WebSvc = 'No'") ds.Tables("DurexBOL").Rows(0)("WebSvc") = "Yes" da.Update(ds, "DurexBOL") Loop Console.WriteLine("City updated successfully") cn.Close() …

Hey guys, I'm new to C and I am trying to find a way to create a file with the following array: [code] char peer1_0[] = { 0x0c, 0x4c, 0x08, 0x00 }; [/code] The original array has a lot more data, but I am just needing a simple example or …

hey guys... can anyone help me in connecting xammp to vc#.net?? xammp is a package and mySQL is one of its softwares... i cant connect to my database... can anyone give me a code/s....tanx guys....

public double getThirdSide() If the triangle is not valid, this should return 0. Otherwise it should return the length of the third side of the triangle. i cant figure out how to put this into coding any help thanks [CODE]public class Triangle { //PART 1 // a triangle is defined …

[B]I would like to read messages from gsm modem and display it on the a form in c#. How to redirect the result on hyperterminal to a form? is it possible to redirect the result? If possible , can you explain me the procedure or some sample code to display …