Software Development Forum

I'm having a little difficulty understanding why a piece of my code cannot be modified to work with stack instead of heap. Well that is just a descriptiom, I'm aware there are no gurantees where my data will be stored. As it stands my working code is... //u_char = unsigned …

Hi everyone, At my new workplace, I've been learning and making a few scripts/macros in VBA to help out with work processes and so forth. Nothing major, but I've taken an interest in it and really want to take it a step further. A lot of this might be amateur-ish …

i have made one program,but it will give none of the port number. Following files i have made **SimpleRead.java** import java.io.*; import java.util.*; import javax.comm.*; import java.nio.ByteBuffer; public class SimpleRead extends SpeedometerExample implements Runnable, SerialPortEventListener { static CommPortIdentifier portId; static Enumeration portList; byte[] readBuffer=null; InputStream inputStream; SerialPort serialPort; Thread readThread; …

Well I need help on moifying my report regarding SearchTree.java(Working with Recursion) "Modify the private report to have an additional parameter which indicates the level of indentation at which the visit should be displayed. The public version of report should be modified to call the private version with an indentation …

I have a UDP server and need to perform an "all" function. That means when a user sends "all blah blah" the server checks a list of clients and sends "blah blah" to all of them. I've stored the clients in a HashMap and I'm trying to figure a way …

*Dear friends: I need a quick algorithm to find the common faces of polyhedrons meshes for the finite volume computation. Each plolyhedron is recorded with the indexes of its six vertices(hexahedron) or four vertices(tetrahedron). Each polyhedron has only one common face with its neighboring polyhdrons. The common face can be …

Hi I am going to solve a problem and have now idea of how, I will that in the list1 only those people that correspond to the date of the date is showing. No one else than that one of the day the word Prn is standing for birthday in …

I have written a super class called Parent.java and it was extended to create a subclass called Child.java. The super class can be compiled properly, but when the child is compiled an error is poped up. //parent class package abc; public class Parent{ protected int st_marks=180; } //child class package …

Hello Friends, Can someone please advise me on how to print an array inside of a GUI text field? Thank you, Jim Here is some of my code. /** This private inorder method recursively traverses a binary tree in inorder. @param btree The root of the tree to traverse. */ …

Hello I am at a lost of how to search for data in a file which was populated through structure. Supposed I have 15 chemicals and each of them contains additional information (e.g. Chemical Name, Chemical Formula, Chemical type, State of the chemical, Antidote name etc). If I want to …

Ok, so my program's input is the number of days someone worked. They earn .02 a day. Each day they work after the first, their pay doubles...(.04, .08, .16....) my code below displays the days worked and the money earned each day. I think i did it the hard way …

I have to submit a C project tomorrow on KD tree and i found this code.I understand some parts of it but rest is out of my head.I know how kd tree is created.Please help #include <stdio.h> #include <stdlib.h> #include <string.h> #include <math.h> #include <time.h> #define MAX_DIM 3 struct kd_node_t{ …

Hello guys, i'm new here. I would like to convert my .txt file which have the following content into an array of int which every elemnt in the array should only have 4 character inside. example: two[1]= 0x03; two[2]= 0x00; two[3]= 0x03; two[4]= 0xf5; This is the content of my …

How to divide a number into multiple parts so that the resulting sum is equal to the input? for ex : input from textbox : first input is(txt_val1) :5 second input is(txt_val2) :3 output : 3+2=5 2+3=5 4+1=5 1+4=5 or any other combinations like these. both input are dynamic always.

#include<iostream> #include<cstdlib> #include<string> using namespace std; class Menu { public: Menu(); virtual void showMenu(); private: }; Menu::Menu() { } void Menu::showMenu() { cout<<"\nFood Selection:"<<endl<<endl; cout<<" ~~*~~*~~*~~*~~*~~*~~*~~*~~*~~*~~*\n"; cout<<" Food Category "<<endl; cout<<" __________________________________\n"; cout<<" 1. Appetizer *"<<endl; cout<<" 2. Main Course *"<<endl; cout<<" 3. Drinks *"<<endl; cout<<" 4. Dessert *"<<endl; cout<<" …

Im doing this game for school and it's supposed to be finished real soon and then of course al the problems start coming up, the game now crashes, sometimes after a few seconds and sometimes directly on start. Don't really know why, a thought is that its doing to much …

In this program I am writing for class, I have to make a Paper Rock Scissor game using functions. I got everything written and everything seems to work until I quit the program and it's supposed to display the stats. It seems that the variables arent storing and being passed …

Hi , I am a final year student, looking for some ideas for my final project. I had an idea of an audio processing program - it will get the notes out from a closed audio file. Does it sound too hard? impossible? My lecturer says that audio processing is …

Hi, I am making a richtextbox to html convertor, I have added features like bold italic underline left align right align center align etc. I found a code to convert richtextbox to html but i am not sure how to use that function. Public Shared Function FromRtf(ByVal rtf As RichTextBox) …

Hey guys, Writing a project for school and having a little trouble. We are creating a social media program and the teacher never taught us to use databases so we have to store all the data in text files. One of the requirements is to for the users to be …

i am tring to debug this problem for about a week but had no luck in it.  Take a look at this image above. This is how i want the bullets to look like. shoot red lines.  Now take a look at this image above. I …

Hello, I'm trying to create a program that installs a directory and then runs some commands in a console of that directory that is installed. I think I could manage doing running the console commands, but I'm having a real hard time in trying to make my program install the …

Hi Everyone...!! Last Week, I Was Assigned A Project Of Building A Mine Sweeper Game In Console.!! I Start Working On It But I Don't Have Any Idea From Where Should I Get Started..!! I Want To Add Some Simple Graphics In My Game, But First I Want To Make …

**Write a C++ program that will make use of the following structure and The typedef Statement: typedef int ArrayType[MaxSize]; The structure is the OneDArray structure, which contains the following data items: a- Name of array. b- Size of array. Use dynamic memory allocation (dynamic one-dimensional array) for storing positive numbers …

Ok, I'm not sure how to format the readline to skip the header columns of the file that is being read in the code that I wrote/spliced in my class. I was wondering if anyone can point me in the right direction here. Thanks in advance! Private Sub btnLoadFromText_Click(ByVal sender …

I have to accept user input, a string, into a doubly linked list and print the output reversed and forward. My professor gave us the following program and told us to modify it. However, I cannot figure it out. /* Program to reverse a doubly linked list */ #include <stdio.h> …

i got this problem from: http://codingbat.com/prob/p178318 This is the question: > Given a string, return the count of the number of times that a substring length 2 appears in the string and also as the last 2 chars of the string, so "hixxxhi" yields 1 (we won't count the end …

I got this assignment from my teacher the other day and i am having a hard time understanding it. I asked him for help and im even more confused. **I AM NOT ASKING FOR YOU TO DO IT. I AM ASKING FOR ADVICE AND HOW TO DO IT** Write a …

I'm trying to take a file that looks like this: >taxon1 ACCGTGGATC CCTATTGATT GGATATTATC >taxon2 TTCATATGTA GGATTTCATA GATGGCCCCC And get it to look like this taxon1 ACCGTGGATCCCTATTGATTGGATATTATC I'm using a python script, so far this is what I have: #!/usr/bin/python import sys if len(sys.argv) < 2: print "usage: finalmyscript.py infile.txt" …

how do you write a code that calls the newline() funtion?

Hello, I'm trying to make my maze game object-oriented. The problem is my mazeArray. I'm a bit confused on how to use it correctly to draw out my maze. Map.h: #include <stdio.h> #include <stdlib.h> #include <windows.h> #include <process.h> #include <cstdlib> #include <ctime> using namespace std; #pragma once class Map { …

Hello. I have a listbox that I would like to display and I would like to set a default selected item, which I will not be able to determine until run-time. Is it possible to set a default item in the program code? I have looked at the Index property …

Hi!I have a project with me which contains this html editor user control designed by someone else. I want to use this control in my project but I don't know how to copy it to my project. Please help me. Attached is the project from which I need to copy …

this time I have only one textfile and I want to remove all duplicate lines so that each and every single line in it is unique unto itself. with open("textfile") as w: for line in w: W = line with open("textfile") as d: c = 0 for line in d: …

i want to find the total space used for the files owned by me from my current directory. i have du -sh `find ./ -user $USER -type f` which gives 8.0K ./.a 8.0K ./t 4.0K ./cat/A 4.0K ./a using -s has no effect. using du -sh by itself includes the …

I am pretty new to Visual Basic, I will be going to programming school soon. As for now, I don't know really anything. Now to my question. I have a couple files I want to install into the C:/ directory. They're all put into a folder. I typed in this …

Hi I would like to know :- 1. after developing a program with vb 6 then I would like to run the setup n install it in different computer,but when i run it adodc not connected with database Can I connected adodc in my computer ? Because my intention is …

Hi, My problem is, the Update query process is painfully slow. Every time user updates a value to a column, it is taking more than 1 min ! I have to update a cerain field Yes/No based on some other field values from the same table. Below is my code: …

i am working through an purchase & sales report.i want to display the purchase report for daily basis using rdlc report how can i do that...can any one help me.....i use date.today to pass in database to fetch the record but how to display that record in report.. sqlcommand=" select …

map<string, vector<int> > // 42 xref(istream& in, // 43 vector<string> find_words(const string&) = split) // 44 error: [errorPic](http://s13.postimg.org/3y4vgjdev/compiler_error1.png) this is a cross-ref program that's written in the book, the exercise told me to create an improved feature for it. So, before I start with my work, I need to organise …

i am creating my user interface by using multiple panels in same form. placing them one after other. each panel visibility is controlled by the button. i am having trouble controlling the visibitity of panels. even BringToFront method isn't working

i am new to spring framework. i have learned basic concept of Spring.Now i am trying to simply run one hello world application using spring. i am getting following error.i dont know why? i am using netbeans 7.2 and spring framework 3.1.1 Release. **hello.java** public class hello { private String …

hi everyone :) im trying to open this project , but when i double click it , vs2010 opens with error on the forms. double clicking the forms shows that the file doesnt exist at the particular directory , even when its visibly there. its probably a trivial thing , …

void boss_animation() { for (int i = 0; i < 4; i++){ if( ! boss[i].drawable) continue; //Puts image of character on screen based on inputs from struct readimagefile(boss[i].frames[boss[i].currentFrame], boss[i].xCoord, boss[i].yCoord, boss[i].xCoord + boss[i].charWidth, boss[i].yCoord + boss[i].charHeight ); boss[i].currentFrame++; //increments the "frame" by one, thus only animating one image at a …

I've done the following code but I can't figure out how to get an output to come out; I used a structure to store both strings and doubles, and then created an array using that datatype. However I can't work out how to create an output. It wont let me …

Hello guys, i'm new here. I would like to convert my .txt file which have the following content into an array of int which every elemnt in the array should only have 4 character inside. example: two[1]= 0x03; two[2]= 0x00; two[3]= 0x03; two[4]= 0xf5; This is the content of my …

does bool work in c(by this i mean a data type that can take only two states 0 or 1 in order to save memory)? if yes then is it included in stdio or any other file is required to be included? same doubt for c++ also mention the syntax …

Okay so basically my problem is that I have to prompt the user for a set of floating point values once . If they do not enter the right data type then I have to prompt them again. If they dont enter the right type the second time I quit …

Hi there, Looking for some desperate help with a problem I am encountering. I have a third party product (bentley Geo Web Publisher) that allows you to specify an xslt to transform some tabular content into a HTML page. Everything worked fine until a couple of weeks ago when I …

I want to know how I can implement a function to open a file and read its contents into a linked list, and then print the contents reversed #include <stdio.h> typedef struct stack { char b[100]; int top; }stack; void push(stack *s,char k) { if(s->top==99) printf("\n Stack is full "); …