Software Development Forum

please help.. how to program nodes(like in binary tree) the root node is (1) then left(LNode) is (2) and right(RNode) is (3).. then for (2)- LNode of (4) RNode (5).. for 3-- LNode(6) RNode(7)..so on.. how can i do that.. then the numbers are in the database.. Thanx

I want to know about function overloading in C# & how to do it? Can anyone tell me with a simple example. Since as i read it from a book i came to this conclusion. I thought it happens only when you use 1 function with same name & tried …

my problem is asking me to write a program that reads a value (say n) from the user and outputs Hello World n times. Verify that the user has entered an integer. If the input is 3, the output will be Hello World printed three times. I have gotten this …

i've recently published an app but i keep getting this error on machines other than mine. unable to load DLL acbpdf8-64.dll, module cannot be found HRESULT:0x8007007E I've copied all the dll's into the /bin folder, so i get the debug and release folders, along with all the dll's, but still …

This is a very simple Rock Paper scissors game i made. i showed it to my cousin and he played it for like 20 mins lol. Its against an AI and you pick by number, not words.

I should write a program for school classification. It should give out all the 5 marks, but nobody can be on the border points or near the border points. Thanks in advance for your help!

public int intRet1; public int intRet2; public void IntRandom(int intNumber) { int intNum[] = new int[36]; Random randomGen = new Random(); intNum[0] = randomGen.nextInt(intNumber)+1; do{ intNum[1] = randomGen.nextInt(intNumber)+1; }while(intNum[0] == intNum[1]); intRet1 = intNum[0]; intRet2 = intNum[1]; } today I tried using *java.util.Random* class, but as you can see I …

Hi, I have some data like this, Actualy bigger than this more than this column and more than this rows. Run1 Run2 Run3 RUN4 Run5 1 23 123 1234 12.33 2 12 124 1225 13.123 3 15 125 1345 32.32 4 18 135 1456 12.23 5 19 137 1563 12.43 …

I have a java application that reads csv file and displays the data on a text area. the idea is to transform this data(source data) into a target data, this involves rearranging it and transforming some elements in each field. now i intend to transform this displayed csv data into …

Hi again I have another query I a struggling with that I would like to get some advice on. Basically put as part of a process we have a number of shortcuts created. These are Windows shortcuts based on an item id - so an example would be 1000.lnk Also …

Hello everyone! I've been having some troubles recently trying to work with frame independent movement (based on 300 pixels per second) and having the object collide with another. I'm still pretty new to this idea, but I don't know how I should go about having the character move back from …

hello guys, I 've just recently stated writing algorithms in Data structures. I want questions to write algorithms in array and linked list, please give me questions in that. The questions can be of difficulty level easy and medium. thank u.

Hi can anyone help me on this..I am tying to change the UIManager. UIManager.setLookAndFeel("javax.swing.plaf.nimbus.NimbusLookAndFeel"); This gives me a lot of Exception. Exception in thread "AWT-EventQueue-0" java.lang.NullPointerException at javax.swing.plaf.synth.SynthLookAndFeel.paintRegion(SynthLookAndFeel.java:364) at javax.swing.plaf.synth.SynthLookAndFeel.update(SynthLookAndFeel.java:328) at javax.swing.plaf.synth.SynthRootPaneUI.update(SynthRootPaneUI.java:120) at javax.swing.JComponent.paintComponent(JComponent.java:778) at javax.swing.JComponent.paint(JComponent.java:1054) at javax.swing.JComponent.paintToOffscreen(JComponent.java:5221) at javax.swing.BufferStrategyPaintManager.paint(BufferStrategyPaintManager.java:295) at javax.swing.RepaintManager.paint(RepaintManager.java:1206) at javax.swing.JComponent._paintImmediately(JComponent.java:5169) at javax.swing.JComponent.paintImmediately(JComponent.java:4980) at javax.swing.RepaintManager.paintDirtyRegions(RepaintManager.java:770) at javax.swing.RepaintManager.paintDirtyRegions(RepaintManager.java:728) …

string using java??please help..the problem is..inputting your name then reverse it.

Ok, here is my question. I got this code working (Yeah it isn't really complex I know, but I'm a beginner anyway) and I couldn't make it work when using a class variable for the strTotalCost and decTotalCost variables and passing decTotalCost to the strTotalCost to show the calculated price. …

I have a code that takes a file and splits the file into two files. The problem I am having is when writing the lower half of the file I have two lines of whitespace I need removed. Here is what I have and am wonder how I could add …

As a project after learning about classes, I'm trying to create a type of board game where the program tells you where all of it's pieces are, and then you tell it where you've moved your pieces, and then the AI moves its pieces accordingly. However I'm having a bit …

Here is a snippet of my code as this is my final and would hate for anyone to find this and copy my final that I am working hard on. Everything else is working and is good. My problem is trying to get the following code to display. void Employee::Calculate …

I have Google'd and all i found was outdated, buggy or not working source samples. Here is what i tried but i have a bit of a problem: [CODE]void toDecimal(char bin[]){ int i, d = 0; int l = strlen(bin)-1; int x = 1; for(i = 0; i < l; …

I want to store a Vector<Vector<Object>> in mysql database. What is the best data Tpye that i can use in mysql and java to store and retrieve the datas.

please help me I'm having error in rs.Open "SELECT * FROM [tbladmin] WHERE [username]= '" & txtUsername.Text & "'", con, adOpenStatic, adLockOptimistic I think my code is right I dunno where I went wrong. Dim strUserName As String, strPassword As String Dim con As New ADODB.Connection Dim rs As New …

I am having two file (File A and File B) of sequence. In File A, thousand of sequences are in fasta format (For example:>seq1 GGTGTTTGCGTGGTTTCATGAAGGTTTTACTaTCCCGAGGAGCCTCATTAAATTGGCAAGA CTCATTAAATTGGCAAGAGGTGTTTGCGTGGTTTTGGCAAGAGGTGTTTGCGGGTTTTAAA >seq2 CTCATTAAATTGGCAAGAGGTGTTTGCGTGGTTTTGGCAAGAGGTGTTTGCGGGTTTTAAA TTTGCGTGGTTTCATGAAGGTTTTACTaTCCCGAGGAGCCTCATTAAATTGGCAAAAAAAA In File B, Two differnt things are avilable first is the sequence number i.e. >seq1 and its position number 10-120 similarly …

This is a Simple one Line code for inserting current System date in to a text box: protected void Page_Load(object sender, EventArgs e) { TextBox1.Text = DateTime.Now.ToString("dd/MM/yyyy"); }

Dim MapString(41, 7) As String Private Sub MapForm_Load(sender As System.Object, e As System.EventArgs) Handles MyBase.Load 'mapfile to array Dim StrSplit(), LineRead As String Dim x, y As Integer 'open the file Dim sreReader As StreamReader = New StreamReader("MapFile.txt") 'x and y must be to 0 x = 0 y = …

Hi guys! I found a source code from the net [Click Here](http://www.sourcecodesworld.com/source/show.asp?ScriptId=1159) about creating an address book. Right now I'm trying to learn how to do it myself by reading diff. samples, the thing is I always see this written in the description and I have no idea how to …

Hi there, My friend and I are making a game, which is based on a tile engine we are making. The map is loaded into an array of integers to represent each different tile. However, in the map class, we need the variable `data` to hold the integer array so …

this might be a silly question :-) but just for reference asking that System.Drawing.Graphics is a reference type ? or value type ? I mean when creating objects like this Protected Overrides Sub OnPaint(ByVal e As System.Windows.Forms.PaintEventArgs) Dim i As Integer = 10 Dim g As Graphics = Graphics.FromHwnd(Me.Handle) g.DrawString(i, …

HI.I need advice on the best IDE i can use to code and what are the reasons. Thank you.

hello friends, could you guide me how i can write my own version of malloc and free function

help me with a c program that inputs a year number and number of years,then to determine which of those years were leap years

God day! Any body has ha clear and good example on how to use Let and Get function? Thank you!

#include <stdio.h> #include <stdlib.h> int fact(int); int main() { int n,total=1,i; printf("enter the series limit: "); scanf("%d",&n); total=total+n; for(i=2;i<=n;i+=2) { total=total+(pow(n,i)\fact(i)); } printf("%d",total); return 0; } int fact(int c) { int j=1; int facto=1; for(j=1;j<=c;j++) { facto=facto*j; } return facto; } my output should be like this 1+n+n*n\2!+n*n*n*n\4! the error …

Hello .. I wish i don't violate community rules :) I was used to work on the NetBeans IDE Now I am converting to eclipse The problem is that i can't neither create nor find the final executable jar file In NetBeans I just press "clean and build" then the …

Hello, I've been using Code Blocks as an IDE for a while and decided to switch to VS2010 Professional as I had obtained it throuh Dreamspark. Anyway, I'm terribly confused at the files it gives me for a standard Win32 Console App for C++. Usually, I'm used to seeing: #include …

I am learning C++ and having difficulty getting my code to compile. I get errors while compiling using VS2010, everytime I attempt to fix the errors it seems to cause a snowball effect of compilation failures. Can someone look over the code and maybe give me some hints on how …

So, in an exercise in futility, I decided to write a script that will take either a file or a string and find patterns in the words, and display the results for a nice friendly human use. Right now, it simply searches forwards and backwards(ish), but Im wondering if there …

Please i need help with this piece of Qt code. It gives a compiled error "**empList' was not declared in this scope**" in the getValue() function. This has got me stucked for a couple of weeks now retarding the pace i'm learning the language. I would gladly appreciate any assistance. …

Do you need to implement a class in order for an object to access the class's functions/methods? When should you implement a class? When shouldn't you?

i just want to ask if you know a formula, or just VERY SIMPLE codes on how to compute days between two dates? i really don't have an idea on how to make it. thank you!

This is the question: Write a program that converts from 24hour notation to 12hour notation.For example, it should convert 14:30 to 2:30 PM. The input is given as two integers. Verifies that a legitimate 24hour notation has been input by using the assert statement Please tell me if my code …

Hello, my code is not transferring the selected row data into the targeted text boxes on the other form when i click or select the row, i need help here , that the code Private Sub DataGridView2_CellContentClick(ByVal sender As System.Object, ByVal e As System.Windows.Forms.DataGridViewCellEventArgs) Handles DataGridView2.CellContentClick If Me.DataGridView2.CurrentRow.Selected = True …

Hi guys, i'm new to C#. I have been trying to create a matrix or size 3x3 with the following code: [code] using System; class matrix { static void Main(string[] args) { Console.Write("Enter values for the matrix: "); int [,]matrx=new int[3,3]; for(int i=0;i<3;i++) { for (int j = 0; j …

/* * error on " byte[] m=args[0].getBytes();" error: array index out of bound exception, help me please */ import java.io.*; import java.net.*; import java.io.IOException; import java.net.DatagramPacket; import java.net.DatagramSocket; import java.net.InetAddress; import java.net.SocketException; public class UDPClient { public static void main(String[] args) { System.out.println("client started"); DatagramSocket aSocket = null; try { …

My understanding of the C language is that the same identifier cannot be reused. However, the code below compiles on GCC without complaints, even when using the "-Wall -pedantic" flags. Is there something that I am missing? Does the standard say anything about functions/macros having the same name as typedef'd …

How can i do scanf's in just one line? because example first i will input a number then i will press enter then the cursor will go to the next line. how can i maintain the cursor in just one line? thank you

This class will sort strings in alphabetical order.

How does one who is encountering VB.Net for the first time start. Sandra

Function cek_code(ByVal pid As String) As Boolean Dim sql As String = "select count(P_Id) from Profit_margin where P_Id = '" & ComboBox2.Text & "'" Dim cmd As New SqlCommand(sql, myConnection) Dim dr As SqlDataReader Dim value As Boolean = False Try myConnection.Open() dr = cmd.ExecuteReader(CommandBehavior.CloseConnection) While dr.Read If dr(0) > …

the question is: Wrtie a program to modify the elements of an array such that the elements that are multiples of 10 swap with the values present in the very next position. I wrote the following code: #include <iostream.h> #include <conio.h> #include <stdio.h> void main() { clrscr(); int a[20]; int …

Hey guys, Im quite new to vb and i've got a school project. Im making a game somewhat similar to the 'idiot test' series. I'm trying to make a counter that will count the number of clicks, which will also be displayed. I'll obviously display it with a label and …