15,406 Topics
 | |
| | Hey guys, I've got a fairly simple script which I'd like to convert (if possible) into a Windows DLL so that I may use it in conjunction with some of my .net projects. Is such a feat possible, if so where do I begin? I've read that there's a book …  |
| | Hey guys, I'm fairly novice at Python so I hope my question isn't too mundane for you all. I've been doing some research into creating Windows Services with Python and came across some useful information with regard to creating one. I've managed to register the service - my problem lies …  |
| | Hi all, How can I declare a global variable inside a module and use it across other modules for throughout the lifecycle of the program? Regards, Dinil  |
| | Greetings: I have [ XRced version 0.2.0-5 ] installed. Please, what about [ XRCWidgets-0.1.7.win32.exe ] : Is this different, more, or less, than what I have installed ? Thanks! |
| | Greetings: The following files are all *.file . This seems wrong. They all contain similar to this: #!/usr/bin/env python from wx.tools.XRCed.xrced import main main() What are they, and can I rename to: *.py or *.pyw ? C:\Python\Scripts\ ================= editra.File helpviewer.File img2py.File pyalacarte.File pyalamode.File pycrust.File pyshell.File pywrap.File pywxrc.File xrced.File Thanks! |
| | Hi all, This is my first thread on Daniweb!. I was wondering if someone would help nudge me in the right direction on this one. I'm new to python, been using it for about 6 months or so trying to develop a network simulator for school. This is not an … |
| | hello everyone! i need help a bit ... //// County/Region 2007Q3 2008Q3 Yr/Yr% Los Angeles 13,583 17,073 25.70% Orange 3,882 5,692 46.60% San Diego 5,673 7,062 24.50% Riverside 9,250 11,714 26.60% San Bernardino 7,038 9,110 29.40% Ventura 1,377 1,676 21.70% Imperial 259 568 119.30% San Francisco 252 353 40.10% //// … |
| | Hello- I do not have much experience with python, although I am trying to write a script to do the following: I have more than one CSV file, in this example I have three, each file has many rows, and two columns, they are in this format: Column 1 is … |
| | Please, how does 'Python, wxPython, wxWidgets, C++' all fit together? WxWidgets being written in C++ and all. What is actually being handed to Python when we use these things. Thanks a bunch! |
| | Hi. I need to have two frames (not necessarily visible together and possibly more than two), and I need to be able to interact between them. For example - if I have two frames, one visible and one not visible. Clicking a button on frame1 will make frame1 invisible and … |
| | I am fairly new to Python, so writing code in it is complicated right now. I wanted to know if anyone knew of a code to send a process started on a workstation to a multiprocessor supercomputer where the job could be finished while still allowing the workstation to be … |
| | Hi there. I am using a RichTextCtrl on a window with a toolbar. The toolbar has a save button on it that is disabled by default when the application starts. I need this button to become enabled when the user changes something in the RichTextCtrl, but I'm having trouble working … |
| | I am trying to run the following screen scraping script but it's not displaying any output. Can someone tell me what I'm doing wrong? [CODE=python] from BeautifulSoup import BeautifulSoup import urllib url = 'http://toronto.en.craigslist.ca/search/cta?query=civic&minAsk=min&maxAsk=max' doc = urllib.urlopen(url).read() soup = BeautifulSoup(doc) tags = soup.findAll('p') for tag in tags: addate = tag.contents[0] … |
| | Hi, I have a python script which uses a COM object. This script works correctly when I run it from pywin, however, it does not run when I run it from windows command line - it throws an exception occurred in this COM object. I know that this COM obj. … |
 | Hi all, Im making a test text game and i got this error when i was trying to run it, after i had told it i wanted to attack: [code=python] Traceback (most recent call last): File "/home/tom/Desktop/Python/Text game/main.py", line 109, in <module> main() File "/home/tom/Desktop/Python/Text game/main.py", line 105, in main … |
| | how do i create a simple interface with two buttons and a picture in the backgroud in python |
| | Hi All, I'm extremely new to Python and would like to create a program to help automate some of the things I do at work. I need to take information from an IDX shell and create a word document with it. Does this sound possible? Would anyone be interested in … |
| | Hi all I was wondering if someone can let me know of a quick and easy way of interacting with a Javascript control on a web page. "<a href="#p189191" name="option66" onclick="selectPollOption(66);" class="vote">Vote</a>" That's the control I would like to activate, I was thinking I could use a regular expression to … |
| | [CODE]#!/usr/bin/python # e begoli, python connector for mysql # import MySQL module import MySQLdb # connect db = MySQLdb.connect(host = "localhost", user = "adamplo1", passwd = "U7RJM5HQ", db = "adamplo1_UniProject") # create a database cursor cursor = db.cursor() # execute SQL select statement cursor.execute("SELECT * FROM User") # get the … |
| | Alright this is my first program in python, so be gentle. I have 2 files I need to basically combine to create a record in mysql. Features.txt has around 1300 records and property.txt has about 25,000 records. I can read in property.txt fine and get my insert statements. My problem … |
| | I am trying to send a message using SOAP. Everything seems to work but no message comes through. I get no error message at all here is my code [CODE]#!/usr/bin/python from SOAPpy import WSDL print "Content-type: text/html\n" wsdlFile = 'http://www.adamplowman.com/sendservice.wsdl' server = WSDL.Proxy(wsdlFile) username = 'adamplowman' password = 'DreamOn' destination … |
| | Hi, just beginning to learn Python, and am trying to create a script that will output matches from a text file to a user's input, I have managed that so far, the problem I have is trying to have something returned if the user puts in a string of text … |
| | I am fairly new to Python and trying towork on this problem. I want to split the file which contains two seuqence of letters by the blank line that separates them then 'compare' them: What you need to do: Text file genesequences.txt contains two gene sequences, separated from each other … |
| | Hello, I am reading this turorial [url]http://diveintopython.org/soap_web_services/introspection.html[/url] and i am trying to echo out all my wsdl method. I am trying to do this on my external web hosting server. I have got the modules installed but i am getting an internal server error [url]http://adamplowman.com/cgi-bin/test_xml.py[/url] here is the code [CODE] … |
| | Hi. The program works fine if i just compile and run. But for the program to get graded it has to pass a test written in python which it does not. Since i'm complete dummy at c and programming if you find to explain, dumb it down please... so here … |
| | First off, I know that to set an indexed variable, say, mylist[3] = "Hello". I also know that you wouldn't be able to set mylist[3] if you didn't first state: [code = python]mylist = ["Whatever", "Whatever", "Whatever", "Whatever"][/code] But, if you had a variable with an extremely large index, it … |
| | I can't really seem to find a jython forum and this question is somewhere between a jython and a python question. I'm trying to get a java Scanner in python. So in java I say myInterpretter.exec("import java.util") and then in python I try and access jav.util.Scanner but it says java … |
| | Hi there. I started with wxPython (Under Linux) a little while ago and I'm enjoying very much, however, there doesn't seem to be a control for working with Rich text. Iv found a few articles (mostly dated a few years ago) that suggest that such a control is on its … |
| | Hi, I am trying to run a python(2.5.1) script on apache2. Basically, I want that when I run this script in the browser on the web server, a gnome windows pops up. The code is as follows: [code] import subprocess def launchExplorer(): path = '/home/robot/Music' command = ["/usr/bin/gnome-open",path] subprocess.call(command) if … |
| | I am creating a tetris-like game. I have decided to use coordinates (x,y) along with a dictionary. Here is a part of the dictionary: [CODE=Python] gameTable = {(-5,10):0,(-4,10):0,(-3,10):0,(-2,10):0,(-1,10):0,(0,10):0, (1,10):0, (2,10):0, (3,10):0, (4,10):0, (5,10):0, (-5,9):0, (-4,9):0, (-3,9):0, (-2,9):0, (-1,9):0, (0,9):0, (1,9):0, (2,9):0, (3,9):0, (4,9):0, (5,9):0, (-5,8):0, (-4,8):0, (-3,8):0, (-2,8):0, (-1,8):0, (0,8):0, …  |
| | I am a bigginer in python and even programming. I want to use python in my thesis for reading and writing large size data. I have a little sample of code which access which runs over the lines and reads each element on a line. [ICODE]def get_site_only(pat): newpat = "" … |
| | Hi everyone, I have been fiddling around with a speech recognition program for a while now and i always had something that bothered me. Here is my code i have been using. It is the example code from code.activestate.com [code=python] from win32com.client import constants import win32com.client import pythoncom """Sample code … |
| | I am trying to have the user of this script define what html tag they want printed from a document and then print all lines between those tags. e.g. [ICODE] <html> <p>;lasdjf;lsdakjf</p>[/ICODE] if users raw input is <p> I want to print ';lasdjf;lsdakjf' Right now it doesn't print anything but … |
| | Hello all, I'll start by saying please bear with me, I am very new to python and I need some help takeing a string with mixed letters and numbers and converting it to a INT. For example [code=python] stringname = '105 mV' [/code] I would like '105 'striped from the … |
| | Currently running python 2.6, wxpython 2.8 unicode win32 on the vista platform... When I try to run a sample app in the wx tutorial section the program stops responding as soon as I mouse over it. Heres the code. [CODE=python]import wx """Example with a 2D grid of sizers of sorts … |
| | Hello all, greetings! I have been playing with DB, seom time ago and want to resume soon where i got stuck. I want to make MySQLdb to get working with wxpython GUI. I got stuck on how to attach the tuple I got from select command to series to the … |
| | Hi , I have a question .. I would like to write/modify the my program ... i.e writing a function to find out which of the directories exists ..... for example : on my computer c:\\sam and in another mechine c:\\xyz ... only one dir should on my computer or … |
| | Hello there Sorry in advance if this post is to big, not sure where else to go. I have just started out with python (last 2wks) with no previous Programming background. I have been really excited with the possibility of been able to program with python and to hopefully develop … |
| | Greetings: I am chugging thru Boa Help Getting Started Guide for Boa Constructor , Kevin Gill , November 1, 2000 and am at Section: 2.7 Creating a Dialog Window doing everything as specified in Help, Save/Run and click on Help/About , no Dialog comes up. [Frame2.py , App2.py , Dialog2.py] … |
| | I'm fairly new to making GUI's in tk so I downloaded activestates GUI builder from sourceforge. It has a very straightforward drag and drop interface and is easy to pick up. However I ran into a problem trying to edit the widgets it creates. It makes 2 files, the first … |
| | Planning to Write a script that reads a Fasta-formatted file and writes the number of sequences in it, followed by the accessions of the sequences. For example, if the input is >Pig ACGT >Dog AGTG >Bunny TATA then the output should be 3 Pig Dog Bunny any idea?  |
| | I ve to Write a Python program that prints a random DNA sequence in Fasta format. That program should ask for the length of the sequence and suggest a reasonable sequence name. The session should look something like: > python randomdna.py Length: 34 >MySequence TGCGCATATTGTCTAACTATGGCTGTGGCCGGA The output must be in … |
| | Probley a really simple one ive got the basis of the Dijkstra’s algorithm [CODE] # findRoute - dijkstra's algorithm. # def findRoute(source, dest): global theGraph theGraph.reset(source) while theGraph.get () != []: u = theGraph.getBestChoice(source) theGraph.addVisited(u) if u == dest: return True for v in theGraph.getNode(u).getNeighbours(): theGraph.addChoice(v) alt = theGraph.getNode(u).getDistanceFrom(source) + … |
| | Hi all, im a beginner, and i need to have fields in a website , soh that users can write on them.. and then i need to get these values and process them in an python program... im lost.. no ideia where to start... anyone can give me a tip? … |
| | Hi. I just joined this forum because I really need some quick advice on a Blackjack game I'm working on. It's my first major endeavor, and I can't quite get it to work right. Here's the code. #blackjack.py from cards import * from graphics import * import random DIM = … |
| | Can any one help me in reading matlab file "test.m" file using python script |
| | ok, so I have to write a program for computer science and I chose to do it in python (obviously) butI'm having trouble getting the program to open the file. here is just a snippet of the coding in question: [I]elif choice == 5: h = open("C:/Users/Dhyan/Documents/" + raw_input("Please enter … |
| | Hi, I have 2 things I'd like help with: 1) is there a way to find the exact center of my screen? 2) a loop Here's what I need the loop for: [code] image = ImageGrab.grab((0,0,800,800)) box = (100,100,400,400) im = image.crop(box) im1 = im.save("screen.jpg") # at this point I … |
| | >>> line = '2008-10-27 12:05:54........... >>> time = line.split(' ')[1].split('.')[0] >>> print time 12:05:54 i would like to add 45 or so minutes to the time i am parsing from a line i have tried print time.timedelta(minutes=45) Traceback (most recent call last): File "<pyshell#44>", line 1, in <module> print time.timedelta(minutes=45) … |
| | Hi guys, I have written this program so far which reads and sorts numbers from a file...WITHOUT the sort function. It sorts from largest to smallest right now. [U][B]My Question:[/B][/U] [B]How do I make my program list the numbers from smallest to largest instead?[/B] [B]File contains the following:[/B] 2 1 … |
The End.