199,114 Archived Topics
Remove Filter  | |
 | Hi, I try to change script source dynamically. When I use the following code, it works fine, and the script is executed [CODE]<script type="text/javascript"> document.write('<script src="http://gamestoenjoy.com/site/test.php"'); </script>[/CODE] However when I use the following code, it doesn't work, the script isn't executed [CODE]<script type="text/javascript"> var url = "http://gamestoenjoy.com/site/test.php"; document.write('<script src=url>'); </script>[/CODE] … |
| | Hello! could i ask where there's any error in my code for testing prime numbers? cos i tried testing 21 and 49, and they were tested as prime. thanks! [CODE]import math y = int(raw_input("Please input a number: ")) if y < 2: print "It is not a prime number." elif …  |
 | I want my to create an explorer like application. What control should i use to show the contents of a directory. I tried listview and listbox. Unfortunately i was unable to add items in a listview using the function getdirectories("D:\") I managed to do so with listbox control. But how … |
| | Using JQuery and CSS with javascript happens a very strange thing...i'm doing a site where every page has 5 DIV in vertcal, called "div1", "div2" and so on. Every page can have a different height, so i use the following script: [CODE] <script type="text/javascript"> $(document).ready(function() { var sH = $(document).height() … |
| | Hi, I am brand new to programming all together and was kind of thrown into a programming class without much help and I have struggled with my homework for this week. I have to create a code to write an ASCII table using Python 2.6 . Here is the actual … |
 | Hello:), I am returning to a theatre ticket booking project after about three months and trying to get my head around how to show the prices in a list box (lstTotal). I have three radio buttons three for three ticket types. Adult Full Concession Friend When one of these is … |
| | How to play sound file like .wav file with javascript and/or DHTML when some one mouseover to a link. I have done this... but it only works in IE while it does not work in other browsers like firefox and chrome. Can any body help me regarding this issue. |
| | Suppose I have a PHP SESSION script, which can load in my friend PC but not run into my PC. Code is same and code running a single server machine! What could be possible reasons? HELP me! |
| | [code=c]MailMessage msg = new MailMessage("myAddress@hotmail.com", txtTo.Text, txtSubject.Text, txtBody.Text); SmtpClient client = new SmtpClient("something"); client.Send(msg);[/code] Both the address "to" and "from" are hotmail addresses. Instead of "something" I tried pop3.live.com and smtp.live.com, but they both didn't work. Can someone help me? And I have a second question. If my "from" e-mail … |
| | Hi I am busy working with biological sequences, but I am having some problems to finilize my script Let's say that I want to compare two dna sequences i.e seq1='ATGGAGGCAATGGCGGCCAGCACTTCCCTGCCTGACCCTGGAGACTTTGACCGGAACGTG CCCCGGATCTGTGGGGTGTGTGGAGACCGAGCCACTGGCTTTCACTTCAATGCTATGACC TGTGAAGGCTGCAAAGGCTTCTTCAGGCGAAGCATGAAGCGGAAGGCACTATTCACCTGC CCCTTCAACGGGGACTGCCGCATCACCAAGGACAACCGACGCCACTGCCAGGCCTGCCGG CTCAAACGCTGTGTGGACATCGGCATGATGAAGGAGTTCATTCTGACAGATGAGGAAGTG' seq2='ATGGAGGCAATGGCGGCCAGCACTTCCCTGCCTGACCCTGGAGACTTTGACCGGAATGTG CCCCGGATCTGTGGGGTGTGTGGAGACCGAGCCACTGGCTTTCACTTCAATGCTATGACC TGTGAAGGCTGCAAAGGCTTCTTCAGGCGAAGCATGAAGCGGAAGGCACTATTCACCTGC CCCTTCAATGGGGACTGCCGCATCACCAAGGACAACCGGCGCCACTGCCAGGCCTGCCGG CTCAAACGCTGTGTGGACATCGGCATGATGAAGGAGTTCATCCTGACAGATGAGGAAGTG CAGAGGAAGCGGGAGATGATCCTGAAGCGGAAGGAGGAGGAGGCCTTGAAGGACAGTCTG CGGCCCAAGCTGTCTGAGGAGCAGCAGCGCATCATTGCCATACTGCTGGACGCCCACCAT AAGACCTACGACCCCACCTACTCCGACTTCTGCCAGTTCCGGCCTCCAGTTCGTGTGAAT GATGGTGGAGGGAGCCATCCTTCCAGGCCCAACTCCAGACACACTCCCAGCTTCTCTGGG GACTCCTCCTCCTCCTGCTCAGATCACTGTATCACCTCTTCAGACATGATGGAC---TCG' Thus my aim is to identify … |
| | Hello seniors, How are you….? I need your help to remove little logical error form user registration form. I have created a user login & registration form. It works fine when I try to reach that form by this method First I put this address in address bar [COLOR="Red"]http://localhost/series/[/COLOR] After … |
 | I am using pagination with search option. Pagination is working perfectly, when I searched and click submit button the no. of records and pagination are showing correctly on first page and pagination. But when I click on next page it will show all records ( means default query) <?php if(isset($_POST['Submit1']) … |
 | Hi I want to learn network programing, but I dont know where to start. I want to do windows networking. Help please |
| | I am working on an assignment for school and i seem to be having some issues. I am using OpenGl with free glut, and attempting to animate a pendulum. I can draw out the pendulum, but cannot determine how to make it swing. I have to make it swing from … |
| | hi all i m facing problem populating jtable with the data of database !m using arraylist to populate jtable .but the problem is that m unable to add databse data into jtables.i m only getting the last row elements of databse. i should be getting this data in the jtables … |
 | Hey there I'm currently going through a guide made by wrox, getting started with a asp.net Anyways, ive stumbled across a problem :( In the tutorial it tell me to access "Profile.Preferences.Theme" however in my Webform, there is no such option This is my current "Web.config" file [CODE] <configuration> <system.web> … |
| | Hi, i am just adding the last component to my registration page, but i am having a little trouble with it. Basically my website includes a referal based system, wherebye when the user signs up they can add a referal that benefits the referal later on. The code i am … |
| | hi all, i have two three dimensional array like this [CODE] $array1 =Array ( [0]= array ( [0]=array ( [name]= praveen [id] = 20 ) [1]=array ( [name]= kumar [id] = 25 ) ) ) $array2 =Array ( [0]= array ( [0]=array ( [name]= pandu [id] = 21 ) [1]=array …  |
| | Hi all, I have this code that seems to work fine for the order but cant get it to pass the invoice side of things. the trouble im having is when i do the order its fine, but when i do an invoice it sends me back to the order … |
| | Hi, I created a previous thread of re-sizing dynamic arrays. I got the answers to that question and I could re-size the dynamic arrays but when I tried to apply similar steps to creating a dynamic array of struct, my program compiles but crashes when i try to run it. …  |
| | Is there any way to execute a wordpress plugin's call tag [CODE][pluginname=parameters] [/CODE] from custom fields? Actually I'm trying with a function and then calling it from the template: [CODE]<?php if ( function_exists('get_custom_field_value') ){ get_custom_field_value('my custom field', true); } ?>[/CODE] but my result is the plugin call tag [CODE][pluginname=parameters][/CODE] . … |
 | I'm currently choosing which data structure to use for my data logging. Just want to ask for suggestion which type of data structure is better. It has limitation on memory either store in microcontroller RAM or SD card. - I can't know the total type of logging it has. (for … |
| | Hi There, I would like to know if it's possible to use or what I could use to get the required results. The values [code] +2711 081 076 086 080 9011 6547082 9013 9039 9086 9041 +27084 substring(table,length(tbl_code),length(tbl_code))=trim(tbl_code) [/code] I have different values lengths in my MySQL table that's not … |
| | ım doing a c# security program this detect the desktop, any human musnt exit from program with use the windows types . what codes ı need |
| | hi... How to kill/abort the request (ie currently processing) to Applicatin server ,like clicking the "submit new thread" button of IE and i want to stop posting .The main thing is that it has to kill the entire process .Is there any java Script to Handle this requests,or we can … |
| | Hi everyone, Can you tell me a way to get the file path (filename) of a file when I "open with" it with my program. I mean that if I open a certain file with my software, I should get the file path of the file. Please Help:) |
| | [CODE]<?php $myServer = "202.138.125.155"; $myUser = "micro_fms"; $myPass = "micro_fms*#$"; $myDB = "micro_fms"; //create an instance of the ADO connection object $conn = new COM("ADODB.Connection")or die("Cannot start ADO"); //define connection string, specify database driver $connStr = "PROVIDER='SQLOLEDB'; SERVER=".$myServer.";UID=".$myUser.";PWD=".$myPass.";DATABASE=".$myDB; //Open the connection to the database $conn->open($connStr); //$table_name=$_GET['Device']; $table_data=$_GET['Data']; $data=(explode(",",$table_data)); $table_name=$data[0]; $speed=$data[1]; … |
| | [COLOR="red"]This is Reservation program full code written in JAVA <from the web> No Problems are in running process. I'm required to convert it to C language.[/COLOR] -- [COLOR="Green"]1- these are lines that i did not understand it. <could any one explain>[/COLOR] a. private static DataInputStream k = new DataInputStream(System.in); //what … |
| | Guys help me please, the equation on 2/3 is giving the waterTemp to 0; how come it is not changing? and also, if the nWaterTemp reached 20.00or somewhere 20.00 to 21.00; it is supposed to print that "THe kettle is now on "Help please [CODE]#include<stdio.h> #include<stdlib.h> #include<cstdlib> #include<time.h> void wait …  |
| | I'm attempting to create a program where the login and password will be verified on an SQL database of user information. I keep getting the error "SQL Execution was unhandled" I marked the code that was causing the error in red. I'm using Visual Studio 8. Keep in mind I … |
| | Hi, I have to use Java to build a scrapper, that takes a product name and searches for that product on an e-commerce website. I understand that I will have to use an external library that would parse the html page for me, given the link. But how do I …  |
| | hello every1 actually m new to vb.net, i have installed oracle 9i on my system and i dont knw how to connect even a simple form to my sql table in which i have two fields named first_name and last_name, the name of the table in sql is user. can … |
 | Hi all , I need to transfer data from jsp to servlet.. am accessing db from servlet .. I need to tranfer those db content to my jsp page how can I achieve that . thanks in advance |
| | Hi, Guys i have an xml file containing near about 6,000 thousands questions in rtf format while inserting these questions into sql server it will give me an error, 2500 records inserted successfully .......... but from that point it will show error, [COLOR="red"]The CLR has been unable to transition from … |
| | Hi, I am create new setup for my project(.exe). While i am click on exe it will throws an error microsoft has encounred a problem we need to close it. System.data.sqlclient.sql what happens , i am installed in another PC it will work fine . I have allready .netfrmawork an … |
| | Hi, Can someone give an example how the following task can be achieved smartly? I have this Database Table with 2 fields [B]1. Brand_ID 2. Brand_Name[/B] [B]SQL[/B] = SELECT Brand_ID, Brand_Name from brands limit 0,12; and I have to loop through it and place the values in the following HTML …  |
 | I've been working on a Linked List assignment. I completed it but I still have a problem on deleting an element that has a predecessor or after an element and inserting an element after an element...can anyone give me an idea? This is what I have so far [CODE] #include …  |
| | [CODE]#include<stdio.h> #include<stdio.h> #include<stdlib.h> struct bst { struct bst *left; int info; struct bst *right; }; struct bst root; void create(struct bst*,int); void preorder(struct bst*); void postorder(struct bst*); void del_leaf(); void del_singlechild(): void main() { struct bst *p; int n,c; char ch; root=(struct bst*)malloc(sizeof(struct bst)); printf("\nenter the info:"); scanf("%d",&root->info); root->left=root->right=NULL; do … |
| | hi .. i need help .. i'm making a login page with sign-up feature .. meaning if you are not already registered in the database you have to sign-up on the sign-up page .. i know how to make the pages but my only problem is .. how can i … |
| | Hello, I am developing e-store in asp.net. I would like to develop it in industrial standards. So, how can I do it? Should I use MVC framework? If yes, Can I integrate it with Visual Studio 2008? Thanks, Hakoo Desai.  |
| | Hello, We stduying the 8086 and 386 using boarland linker. while stduing for a test I have I came across a queation about menaging and printing 64bit numbers. the numbers are represented as an array of chars (8) and I need to implement a rutine that puts the number in … |
| | We are asked to input 10 integers where in we need to display: 1. The sum of all the odd numbers 2. The sum of all the even numbers I do not know how to make a statement and i do not know whether to use for or while and … |
 | hey everyone, I'm just having a problem debugging this line and I don't see anything wrong with it. I tried using SelectValue and other ways but nothing seems to be working. The error message I get is that Exception Details: System.FormatException: Input string was not in a correct format. [CODE] … |
| | I use VS2008 where I have a program where I have about 20 tabpages with datagridviews and textboxes. But when it comes to printing windowsforms the sollution is just not good enough, and of course på programming skills is not good enough either. I want to print out the data … |
| | how to call oracle report using form builder on which command button.If i press command button report should be run. |
| | Hello c++ experts. Please help me with this kind of program >.< i wanted to make my integer converted to string. For ex. I input "1" and the output must be in string "one". Sorry if i request this just need this for my homework. Thanks in advance! |
| | I'm having issues in populating a select list in IE. The following snippet works fine in Chrome, Firefox and Safari browsers. Are there any obvious known issues with this snippet that would prevent the information populating? I can't figure out if it's the button IE doesn't like of the Select …  |
| | Hi, When i use realloc to re-size my array it is re-sizing it correctly but my some of my data is getting lost. Strange thing is that If I don't use realloc, I can still re-size my array by just increasing the index before inserting the data. In this case …  |
| | Problem 4 – makeScarf(scarf) Let’s knit a scarf! With Python today we are knitting recursively. Your main program should be contained in a recursive function called makeScarf() which takes a string: your scarf that will be printed out in the end. You may use other helper functions as needed, but … |
| | I am working on a "searching" program. But it always returns a "." as the up directory or whatever. And I can't do an if statement to check if its a period or not. The goal is to get the only name of the folder in that directory. There is … |
The End.