Software Development Forum

hello, i was looking at a program someone wrote. I saw something like that: name = (char*) strdup(path); strdup already returns char *, so why do we need casting here? did he do a wrong thing or am i wrong?

Here i am posting again the program for creating the table of contents which are filled according to the user with dynamic arrays but yet the problem regarding the output is not solved ,i know dry run is correct , compilation is free from errors and warnings,builtable() function is working …

Hello Everyone, i have made programs of exceptional handling in cpp, but i am not able to run them in Turbo c, what i have to do to run them plz. explain. thanks

Basically I'm trying to run a simulation of neurons and this is the code that gets run in the main loop of it. [code=c++] class Neuron { private: double v, u, a, b, c, d, current, du, dv; public: double x; vector<double> pre; int id; vector<int> fired; vector<int*> post; vector<double …

i wrote a code for download image from the website using URL class in java.The code is working fine.But the problem is after some time it shows- java.net.ConnectException:Connection timed out .Here i didnt use any proxy server and firewall.some sites gave soln as like change proxy settings or it is …

Hi friends, I want to copy few cells of an excel sheet and paste special(picture) in ms-word. I want to develop a vb code code for this. Please help!... Regards, Dinil

<<snip>> Original article can be found: here: [URL="http://www.geocities.ws/jeff_louie/safearray.html"]http://www.geocities.ws/jeff_louie/safearray.html[/URL]

Hey guys, I'm making a platform game similar to Super Mario in Pygame and I want to add platforms i.e. I have a background picture that has platforms drawn on it. I then want to make it so he can only go down as far as the platform, and as …

nw i hv been tryin a stuff tht m really nt sure if u guys understnd at once..bt sum1 hs to find a solution for it plzzzzzzzzzz... i need a code in C++ to do the following tasks...:- 1.) copy files from a folder 2.) save them in a different …

I wrote a code to get factorial for a number uptil 100. The problem i have is that i have to display the array it is sstored in a single output. So i cant use for statement and print each element. [CODE=CPP]#include<iostream> #include<cstdio> using namespace std; int main() { int …

import javax.swing.*; class Customer { int id,rate,pre,cur; String name,sex; String read(String n) { return JOptionPane.showInputDialog(n); } int readInt(String n) { return Integer.parseInt(read(n)); } void out(String n) { JOptionPane.showMessageDialog(null,n); } public Customer() { id=1; name="Visal"; sex="Male"; pre=13214; cur=13362; rate=720; } int consumption(int pre,int cur) { return(cur-pre); } int payment(int rate) { …

guys... im on a program now.. i have this prob... that when u inter a number a asterisk would be the out put in a form of a trapezoid... - i got stuck hir guys... #include<iostream> using namespace std; int main(){ int VALUE=0; cout<<"inter VALUE: "; cin>>VALUE; cin.ignore(); for(int i …

Hi guys, i'm new here and new to c/c++ programming. could you guys guide me how to extract some character/number from a char string? Example: char = TAGNAME_C123_V45_S67_M89 i want to extract the numerical number next to the character. The TAGNAME and the number is varies. So my code should …

I recently downloaded the Eclipse(Ganymede) EE editor.I also downloaded the web application server community(WASCE 2.1) edition from IBM. I started off with a simple HelloWorld web application.i just displayed the msg in the default index.jsp page. When I deploy the application on the WASCE server the web browser is showing …

;A program to display the message, "ASSEMBLY LANGUAGE PROGRAM" on the screen. ;MODEL MEDIUM ;STACK Datasg SEGMENT; Beginning of data segment message DB "ASSEMBLY LANGUAGE PROGRAMMING" Datasg ENDs; End of data segment Dispsg SEGMENT; Beginning of code segment ASSUME CS:Dispsg, DS:Datasg ORG 100h john: MOV AH,09h; 9 is function value …

Hello I believe that VS 97 is a very good tool for programmers and i m looking over it 2years now.I had a copy but unfortunately the cd after some years is unreadable and i cant work.Guys. I need this tool and i can not find it on internet.If any1 …

Hello Everyone! This is my first actual post although I've been a member for almost a year. I'm writing a program that will create a random number between 1-1000 and ask the user to guess the random number. I also have the program display an error message to tell the …

Hi. I have a Vector of Vectors that I need to rotate 90 degrees clockwise and 90 degrees counter-clockwise. I got it to rotate Clockwise, but whatever I try, I can't get it to rotate counter clock-wise. The 2D Vector is not always going to be a square. It will …

I'm currently taking a introduction course to C++ and I've been able to do the first 3 assignments without much problems, but this new assignment is kicking my butt. The goal of this program was to make a simple text editing program. I simply open a saved text document and …

Greetings all How can i create an executable in run-time? (win32). i need a simple wrapper for different console commands. this is because i must have executable there is no way around it. so what i have come up with is passing the command that i want executed as a …

I have posted this thread in the microsoft software forum as well but with no luck. If anyone can tell me how I can save a active excel file using a macro to save it in a folder using the current date as the file name. I hope that was …

Hi! I am trying to design and build a plugin-system to a project of mine. The basic design is to use DLL's for each plugin. Each plugin have a special function that loads all of its functions as macros to the main engine, which has been passed as a pointer …

on line 53 it says menu is undeclared. but if i bought menu first then mcdonalds is undeclared. does anyone know how i can sort this out? ty [CODE] #include <iostream> using namespace std; double money = 50.00; void Mcdonalds() { cout << "Welcome\n"; cout << "How can i help …

Hi, I know the return value of generic search algorithm "find()" is of iterator type. Now how can I output the return value as numeric type? For example: [CODE] short myArray[4] = {2,1,3,7}; vector<short>mVec(myArray,myArray+4); vector<short>::iterator found; found = find(mVec.begin(),mVec.end(),2); [/CODE] In this code the variable found will be assigned the …

I am attempting to see have much run time a program takes, and eventually check the runtime of different pieces of the program. (As it runs it seems to get slower and slower without explanation) Anyways, I tried the sample code posted on a super simple program. If I wanted …

Hello everyone, My file has lines like: >9|102396631|genome..... CCACTTTCTCTCCGCGCTGGGTTGAACATGGTACATCAGACTCCCTGAATCTGTCAGATC TCTTGGTTGCTGTTGACAACTAAGACTTCGGAGCCTGGAG_GATTTGTTGAGGGGGAGCA GTTCTGGGTGTCCTCTGCTGTGACTGGGCTCCCGGCCTCTTGATAATGCGCAACAGCTGC GGTAGAACATCTCATTCCCAG >9|102362951|ENSRNOS.... I want to delete blank lines from this file please help me... Thanks

Hello, everyone! I have a problem with memory free. Here is the necessary code to understand the problem: [CODE] void fillArray(char** referenceArray, FILE* grid) { //Chaîne qui va contenir une ligne du fichier. char* lineContent = malloc((width + 1) * sizeof(char)); //Pour contenir le "\0" int i, j; for (i …

Hi everybody, I am having some problems with a multi-threaded application I am developing. I get segmentation faults in different places, always related to std::string, using g++4.3.2 on Ubuntu 8.10 server. Here is an example: [icode] #0 0xb7e18bb6 in memcpy () from /lib/tls/i686/cmov/libc.so.6 (gdb) up #1 0xa8eb1014 in ?? () …

[code] i read that a method that is is using throws clause must be mentioned in the try and catch block.So when we use "throws IOException" in the following program why dont we use try and catch import java.io.*; class testthrows { public static void main(String args[]) //throws IOException { …

anybody help me!! i have one tombol that tombol will be used to evaluate the explain!! i have some question with answer choise(a,b or c) with that tombol i want know if my answer true or false!thanks can you show me with a simple database and last question from me …

Hi, I am trying to write some code to insert coordinates which are taken from the mouseClick position and then added to a 2D array. The user should click 6 positions on a panel and these positions should be stored in a 2D array. I hope you can help. Thank …

How do I import a variable from another function in the same class [code=Python] class W(object): #my class def variable(self): #one of my functions f = 5 def printf(self): #what do i put here to import f from the function variable... #I'm currently working with python 3.1. #I know its …

Hi Guys, I have written a windows c# service that basically write out some text to a file in the onStart function. The program works fine when i manually start or stop it. Now if i leave it started and restart my system, the service does not seem to do …

im trying to draw a curved line using mouse. there are three points on a straight line. a starting point, an ending point and a point in between. i want to draw a curved line by dragging the middle point in any direction. the other two points remain constant.

Hello everybody, I started c++ half a year ago, with the .cpp programs. Now i want to create a program with the Windows Application forms. But how can i multiply with textboxes? I want something like: textBox1->text = (textBox2->text * 3) But this code gives an error, i need something …

3. Create a class by vector with an array of” int” type as its member data (The array created dynamically)find the last largest and avg value of the vector 4. Explain the sequence of steps to be followed in performing the following operations over a binary file catching of empty …

I have a main form and I have menu's that open up within the form, but when I open a menu they open off the form. What do I need to do to make the forms open at the center of the main form? Thanks

[code=c++] #define MIN_PASS_LENGTH 6 #define MAX_PASS_LENGTH 12 #define NUMBER_OF_PASSWORDS 3 #include<iostream.h> #include<stdlib.h> #include<time.h> #include<conio.h> #include<fstream.h> #include<string.h> //int i; //letters //int j; //numerals char rand_small_letter() { int nHigh = 122; int nLow = 97; int small_letter = ((rand()%(nHigh - nLow + 1)) + nLow); //values from 97 to 122 return (char)(small_letter); …

I have not yet started this, I want some advice on how to proceed before I waste too much time! I am writing a Service which listens on a COM port, parses input, and stores relevant data to a database. I am fine with all of this, except I need …

I wrote this program back in high school 10 years ago and I found it today. I'm getting back into programming and I'd like to get it working again, some of the headers are deprecated which I tried to fix, and I was using borland c++ and now have Dev …

i have a datagrid .its name is dg and a button its name is btn. I want print my datagrids information by clicking on the btn. I need it urgent.

Hello~! ...again.. I got some help from you guys a while ago with this same app because it wouldn't run on winxp. It runs fine now, but my brother is still telling me he cant get it to work right...so rather than go through all the trouble of trouble shooting(he …

1. Create a class by name student with the necessary member data provide the facility. A. Create a list of stack B. search a student by reg.no 2. Create a class by name dates A. overload “<” operator to compare two dates B .overload “++” operator to compare date by …

Had a repeater giving out an rss xml data feed, but it took too long to load, so I'm using an ajax incremental page loader and need to get the xml into an innerhtml format so I can write it back to the page's div tag via a web service. …

Hello.. Im trying to pass an integer to a function by adress because I want to change the value of the integer in the function. But it will not.. please help. Here is my function call: [code=c] insert_sorted(&VH, &L, n); [/code] Here is my function: [code=c] void insert_sorted(VirtualHeap *VH, LIST …

I'm developing a recursive method for a class which will return a complicated data structure (a list of dictionaries which will contain lists of dictionaries as values). The data structure could be something like that: list<map <string,list<map <string,list< map<string,list<...> > > > How can I refer to this structure while …

Hi I want to store value from a row into a variable. I have used the following coding but it is not working properly. It is generating the following error: [B]Index was outside the bounds of the array.System.Data[/B] Please note that the table contains only one row. [code] objSqlConnection.ConnectionString = …

here is a code [CODE] #include<stdio.h> int main(void) { int b[10][5] ; int (*q)[10][5] = &b ; printf("%d", (char*)(q+1) -(char*)q); } [/CODE] the output it produces is 200 while if I change the typecast to (int *)(q+1)-(int *)q, the output is 50. I know that q is a pointer to …

Hi I use the reporting services to generate the report.I use query like "Select Distinct(ID) from Table1".In that query Its generate the number of ID ,So In report user able to several "ID" at one time,so I think if I can use combo box then user can select ID which …

Hi. In my attempts to create an email client, netbean's GUI builder has made me very unhappy... so, I decided I'd rather code it by hand... not my best idea, but whatever. Now, I'm trying to nest a Vertical JSplitPane in a Horizontal JSplitPane, and I can't see the left …