Software Development Forum

Hello, I'd like to create a function that accepts two objects and compares properties between them. Example [code=java]public boolean (obj1, obj2){ if obj1.property1 = obj2.property2 return true else return false } [/code] How can I do this?

Greetings: I am chugging thru Boa Help Getting Started Guide for Boa Constructor , Kevin Gill , November 1, 2000 and am at Section: 2.7 Creating a Dialog Window doing everything as specified in Help, Save/Run and click on Help/About , no Dialog comes up. [Frame2.py , App2.py , Dialog2.py] …

Hai there, I would like to ask about currency format in Bash script let say i have $US2550000, after format it, it become $US2.550.000,00 Thanks for the help

I am trying to count the number of each letter grade for a list of students and count how many are male and female and how many students there are total. The problematic section is: [code] int ItemType::CountItems(int& ACount, int& BCount, int& CCount, int& DCount, int& FCount, int& MaleCount, int& …

Hi all, Can anybody help me out with the connectionstring for connecting VB6 to a Microsoft SQL Server 2005 Express Edition. I have tried several documented varieties which do not work. My latest attempt was a version from [URL="http://msdn.microsoft.com/en-us/library/bb264566(SQL.90).aspx"]this website[/URL]. I downloaded the application and associated files and changed the …

i would like to make a winamp plug-in.can any1 help me to show me the way how to write the code,please?? thanx.

Hi all, I'm a C++ programmer and now about to use Visual C++. May I know the difference in terms of functionalities? will my code written in classic C++ run on Visual C++? thanks.

I'm trying to read in a text file character by character. However, when I try to read it in it using the readChar method in DataInputStream it gives me a IOException. Heres what I have so far [CODE] FileInputStream stream; try { // Open an input stream stream = new …

Hello to all of you! I would really appreciate somebody telling me complete step by step tutorial how to work with MASM (or TASM, but I haven't noticed it's free to download) I've tried myself MASM and TASM (some Telemark assembly, not Borland), but for some reason it won't work, …

I'm fairly new to making GUI's in tk so I downloaded activestates GUI builder from sourceforge. It has a very straightforward drag and drop interface and is easy to pick up. However I ran into a problem trying to edit the widgets it creates. It makes 2 files, the first …

I have a buffer of chars. I want to display them in a text box as hex. is there a simple way to do this? Thanks.

Hi guys, being a beginner I have some trouble with pointers. I don't know but something about using pointers is just not getting clear to me. My assignment requires that from an array of given values, the user inputs a particular integer whose every occurrence with in the array should …

Almost every site I look on has at least one, and probably more, people who are going to write their own operating system. What's the point? When its finished the chances are nobody is going to use it - probably not even you. I might not mind spending a few …

I ve to Write a Python program that prints a random DNA sequence in Fasta format. That program should ask for the length of the sequence and suggest a reasonable sequence name. The session should look something like: > python randomdna.py Length: 34 >MySequence TGCGCATATTGTCTAACTATGGCTGTGGCCGGA The output must be in …

Okay, so I'm well read in VB and quite an avid VB programmer but I realize that programming in visual basic isn't very marketable and above all I only use it for fun. I wanted to move to C++ but noticed that it was a LOT harder, and worked completely …

Developing an applet , which queries information from database and displays. Database used is sqlite. Application Envi:: Application runs on the local machine and the database file is present locally. The application is run inside Web browser and not in the appletviewer. Due to security restrictions, applet doesn't allow application …

Hi I have a particular problem in returning an element of a struct which matches a maximum of another element here is part of the code, which will work, but does not display the details[i].title, which part of my original Struct declaration. What am I doing wrong ? [code=cplusplus] int …

Hi, I want to use outputs from different forms of a project and save them into a single text file that could be from a module. Please suggest any tips on this. Abhishek

when i am using graphic in my program and copy the .exe file in another computer where c++ is not available its return a graphics error(EGAVGA.BGI) is not found. why?? and how can i solve this problem.

I need to do some calculations in VB and display the results of the calculation as a decimal number like 1.62. In my code several variables have the Dim Double and some have the Dim Currency. The result of the calculation is always shown as a scientific number with a …

hi all, if you look at the code below you will see that i am trying to get a template function to return an iterator based on the type type of one of its parameters, i cant seem to get it to work i dont want to have to pass …

right i am really really sorry i have left it until the night before hwk is due in i need to make a program that; inputs student data outputs students data edits previously inputted student data deletes previously inputted student data if anyone can help me, give me a basic …

Hi, I need to write C++ code to find the factors of a polynomial.For eg. X^2-1 should return x-1 and x+1...anyone have any ideas on how to do this?

Sorry to everyone, I figured this out just after I posted, But i do still have another question, For a certain operation I am required to use log's in determining a variable for example Var3=log(Var1/Var2)/log(8) but java doesnt seem to accept log. What is the appropriate way to use logarithm? …

hi i have created application that uploaded files (.zip, .doc, ... any type ) to file system and then i have create another code to download the files but i need so have the option to open also the file if i do not need to save it on my …

I need a little help converting my GUI panel into JButtons instead of text for some parts [code] //Davina Moore //TempConverterPanel //November 6, 2008 import java.awt.*; import java.awt.event.*; import javax.swing.*; public class TempConverterPanel extends JPanel { private JLabel input, results_f, results_c; private JButton output; private JTextField fahrenheit, celsius; public TempConverterPanel() …

Hi. I just joined this forum because I really need some quick advice on a Blackjack game I'm working on. It's my first major endeavor, and I can't quite get it to work right. Here's the code. #blackjack.py from cards import * from graphics import * import random DIM = …

hi I have crreated a conde to try and take input rom a user as a string then break it up into bits and pass it o it's functions but the values are not releacting at the functions and anyone has any other way o converting a string into a …

Hey Guys., Im super desparate have 1 day to hand this in. Have to use loops only. quote: The use of any of the following C statements or functions is not permitted under any circumstances. break; continue; exit(); abort(); No global variables. When the program starts it will prompt the …

Hi how are you all?hope fine I need quick help please, i'm a computer science student, in fourth year,and i should have a graduation project,the problem is i cannot find a good idea yet, so i need a quick help. i think a bout something in "java applet" ' but …

Hello, I have just started using Delphi and ran into a small problem. It's a simple app, as I am only practicing. It has a Button and 2 Edit boxes. I want the user to enter some text to be saved (in a .txt file) in Edit1 and choose a …

Hi All, I need help figuring out how I can call the various functions in this program from main. I've figured out as much of the code I could, but now I'm stumped. Any help would be appreciated. [code] #include <stdio.h> float deposits[50] = {0}; float withdrawals[50] = {0}; char …

I have trouble with getting the correct number of characters displayed when returning this simple function. Does anyone see what I am doing wrong in the function (the cout function outputs -2 instead of 4 which is the lenght of "test")? Thanks: [code] #include <iostream> using namespace std; int mystrlen(char …

I have a text data file including a lot of double data set as below: the dta are separated by 3 spaces. x x x x x x x x x x . . . x x x I want to read these data line by line and from left …

ok, so I have to write a program for computer science and I chose to do it in python (obviously) butI'm having trouble getting the program to open the file. here is just a snippet of the coding in question: [I]elif choice == 5: h = open("C:/Users/Dhyan/Documents/" + raw_input("Please enter …

[code=csharp] using System; /// <summary> /// Summary description for Class1 /// </summary> interface I { void dis(); } class B:I { public virtual void dis() { Console.WriteLine("dis() in Base"); } } class D : B { public override void dis() { Console.WriteLine("dis() in Derived"); } } class c2 { public …

hi all, here i got strucked on auto incrementation of version using c# ,iam trying to do it programatically but i could able to change version number in variables but iam not able to write it back as it is read only.Is there any alternative for this?. my code is …

I'm writing a class for simple equation parser. I've completed the - and + operators, and am currently working on implementing brackets. They seem to work most of the time, except I occassionally get strange results, such as with 10 - ((10 - 20) + (10 - 20)) returns 40! …

Hello., i have sql server in my pc and i want to connect my visual basic form to my sql? how can i do that? what is the code i have to write in the modules? please help Thanx in advance...

I am a 17 year old beginner to C++ I want to find a beginner project that I can set my mind on so I can have a clear goal. What projects do you recommend? Please make them beginner friendly. I am having a huge problem with lessons, so I …

hi, i'm trying to figure out how to fix this warning: decode.c(77) : warning C4715: 'get_msg' : not all control paths return a value i understand that my get_msg could not always return a value, i'm just not sure how to state that in my code? can anyone suggest anything? …

Anyone who coulf help me in loading listview items to another listview? i want to load items one by one using "selected" property and all items by using "For each" statement.. and also i want to know hoe to track down duplicates with 1 column as a basis.. anyone who …

Hello all, I was wondering how I could make this with larger numbers instead of scientific notation or whatever it is. I have attached my code and here is what I did: 1. Typed in E for exponent and hit enter. 2. Entered 9 and hit enter. 3. Entered 9 …

Can't figure out a for statement that will make this function work...help please ASAP Receives nothing from main Returns an even integer Ask the user for an even integer Read in the user’s input value. Repeat the prompt and input for any invalid numbers until a value of the correct …

Hello everyone. I wanted to know how I could create a simple time restriction variable. For example making private double hour; not go over 2:59. Basically I don't want someone to be able to input a number greater than :59 in a Jtextfield. I can do a time application, but …

Hi, I have 2 things I'd like help with: 1) is there a way to find the exact center of my screen? 2) a loop Here's what I need the loop for: [code] image = ImageGrab.grab((0,0,800,800)) box = (100,100,400,400) im = image.crop(box) im1 = im.save("screen.jpg") # at this point I …

after you switch (variable) case 1: etc.... if the switch defaults, how do you return to repeat the switch case? do you just do a simple cin>>var and it will reset or you have to loop it? Sorry if question isnt clear

hey i need this for my exams the gave me a summary about a program which gets password from the user an saves it inside the exe itself.you can also give me help for encription please do write the source code

Hi, I'm trying to finish a college project for tommorrow, but am having real problems with my code. Every time I try and run it, I get an error message saying 'Expected If'. I looked and looked at it, but can't for the life of me work out whatthe problem …

Consider d_type=POINT_LONG in the following program. and data.Long=0xA; In the following program i am getting correct output in constDataArea[0],constDataArea[1],constDataArea[2], constDataArea[3] which is oxA, 0x0, 0x0, 0x0. But not able to write the same into ambi.dat file. Some junk value is inserting in the front. and writing 5 bytes instead of …