132,726 Archived Topics
Remove Filter ![]() | |
I Have Listview with All transaction with column InvoiceNo Date Customer Total Now I want to filter only month transation only month with combobox selection and one textbox year Me.cboMonth.Items.Add("1") Me.cboMonth.Items.Add("2") Me.cboMonth.Items.Add("3") ........... Me.cboDate.Items.Add("12") Me.cboDate.SelectedText = 1 my column date display mm/dd/yyyy How can I selection cboMonth to filter only … | |
Hi All, Here i want to disable right click on textbox. Please help me to do this. Best Regards Neji Software Development visual-basic | |
I am opening windows calculator in my MDI windows application and it gets open through a child form which is a part of mdi form.I am not able to close the windows calc even when my form gets closed. code: [CODE]System.Diagnostics.Process p = null; public bool calcinstance() { if (p … Software Development | |
This is the code and there is something wrong with the check column function. I am unsure and need help. #include <iostream> using namespace std; int sudoku_solution[9][9]; const int array_size = 9; inline int random() { return rand() % array_size + 1; } bool check_column(int value, int row, int column) … Software Development c++ | |
Hi, I have a program that needs to create a downloadable excel template with the following headers on the first row named, name, age, gender. And I also want the template to only have 1 sheet on it. how can I create a sample template using vb.net code? Thanks Software Development microsoft-office vb.net | |
Hi, I have this program that would upload files from the client to the server, Now I want to validate the filesize before uploading it into the server.. How can I create this kind of validation? Thanks. Software Development client-server vb.net | |
I want to stretch an image in picturebox. Is there any property to do it? In VB.NET there is is a property called "size mode". we can change that property to "stretch image". still i couldn't find VB6 property to do it. Please tell me the property or if there … Software Development image visual-basic | |
Here is my HTTP cookie request which auto loads browser after doing the cookie stuff. But it does not login and i dont know why =/ [CODE] Dim logincookie As CookieContainer Private Sub Button2_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles Button2.Click Dim postData As String = "referer=http%3A%2F%2Fforum.ea.com%2Fuk%2Fcategories%2Flist.page&selectprofile=true&remoteurl=http%3A%2F%2Fforum.ea.com%2Fuk%2FgusUser%2Flogin.page&action=Login®istrationSource=&authenticationSource=EA-JForums&HIDE_GUS=&username=" & … Software Development vb.net | |
Guys, I can't still figure out how to show to a user the file info of a file programamtically. Can I just use the Properties window that Windows use to show all the detals of a file (e.g. name, type, size, path, date created ect.) I am using the IO … Software Development vb.net | |
Hey everyone! I am trying to writing a program that will play hangman. I have an understanding, on paper, of how to write the program... but I just cant fully convert it into java. I have started the program but I've gotten to a point where I'm stumped. Any help … Software Development java | |
Hello all, zoidmaster here. I have a question regarding Visual Basic and deleting lines of text from files. I'm trying to make a piece of software to manage customers who walk into a store. I got most of it written already but the problem I'm running into is deleting some … Software Development file-system vbscript visual-basic | |
I am having and issue getting my add to list function to work in my data structure list class. I have all functions working except addToPostion. addToHead, addToTail, deleteFromhead, deleteFromTail, and DeleteFromPosistion all work as expected. I'm confused on the addToPosistion. The entire .cpp file is posted. Any and all … Software Development c c# c++ data-structure | |
Hi everyone, I have been working with VB6 for about a week now, so I'm still a newbie. I have a pretty big project coming up and I have a question relating to the capabilities of VB6. I want a GUI that has a "Model" tree on the left, and … Software Development data-structure gui visual-basic | |
Hi, I wrote a drawing tool program by using vb6. I scans a big house plan (A3 size) and load many little pictures as the element of the house. The user can manipulate the house plan and saved it back. I used normal vb6 method to load and save the … Software Development visual-basic | |
I am trying to develop (on c#) a Point of Sale program(deployed on machine 1), with integrated kitchen display system(deployed on machine 2). I pretty much have an idea how to develop the individual programs, however, I haven't tried integrating thee machines (to function as one) before. Here's a brief … Software Development c# client-server display queue | |
Hey guys, I am playing with the .NET 4.0's new class Parallel. I tried to open files in a directory and calculate the total bytes of them. However when I run the code, I get a different result every time. Can you explain me the problem I have? [CODE]using System; … Software Development file-stream multithreading | |
I'm designing a software that will help novice Google users get the most out of it. The software takes-in the query, parse it, optimize it and send it to google.com for searching. What advice do you have for me. All advices are welcomed... Software Development google seo visual-basic | |
Am, with baby steps, becoming acquainted with the boost library. So far I'm compiling examples. From the tutorial, there is a very short regex-example, mostly there to test that the library is linked correctly: [CODE]#include <boost/regex.hpp> #include <iostream> #include <string> int main() { std::string line; boost::regex pat( "^Subject: (Re: |Aw: … | |
Okay so this is another question printing patterns but this time using input! I have to prompt the user and read an odd number from the input. I can only use System.out.print('*'); System.out.print(' '); and System.out.println(); I need to maximize my use of repetition and minimize the number of output … Software Development java programming-construct | |
When I export the program to a executive Jar, file.txt does not import. The file.txt is in my src folder. Everything works file when i run the program in eclipse but when i export it, it does not import. HELP, I am new to Java and everything. Software Development java | |
ok, I'm pretty embarrassed to be posting such a simple question, I feel like I've done this in much harder applications like a million times... [CODE]String[] wordVar = text.split("$");[/CODE] Why does the above code not split the String 'text' at each occurrence of a "$"? Is the "$" a special … Software Development java | |
I have a question for all you experts who have had similar experiences as me: Is there a solution for this malware on the site? An infection on the Linux server, where we're constantly in the Wordpress script generates files of type wb 5433712.php antimalware program is a malware called … Software Development php shell-scripting virus-malware | |
I've got a little inventory management system going, and it searches for products by name. It also loads old data from a file on the hard disk. For whatever reason, when it loads the name, it doesn't accept the name that it displays in the save/buy functions. If that doesn't … Software Development c++ | |
I'm writing an assignment for my introduction to programming class and we're supposed to implement the following interface: [CODE] public Interface Account{ //Calculates interest (1%) and adds to the account balance public void interest(); //Calculates the balance after a deposit public void payIn(double money); //Calculates the balance after a charge … Software Development java user-interface | |
Hey guys been working on a java Program. I am having a problem with my percent rounding up to 7% instead displaying 6.5% any ideas here is my Program. [CODE]import javax.swing.JOptionPane; import java.math.*; import java.text.NumberFormat; public class Week_three_number_eleven { public static void main(String[] args) { String Investment = JOptionPane.showInputDialog(null,"Please enter … Software Development java java-swing | |
Some1help me.... so how to save the pictures i drew to jpg if possible load and edit a jpg file. [CODE]using System; using System.Collections.Generic; using System.ComponentModel; using System.Data; using System.Drawing; using System.Linq; using System.Text; using System.Windows.Forms; namespace @try { public partial class Form1 : Form { private Graphics picture; private … Software Development c# | |
So I am stuck on my assignment where I am suppose to make mortgage calculator and I am suppose to do the following things: 1. Mortgage Calculator : prompts the user for (a) principal, (b) Annual interest rate , (c) number of months.It calculates the monthly payment and prints the … Software Development c++ | |
I have text file as follows seq.txt >S1 AACAAGAAGAAAGCCCGCCCGGAAGCAGCTCAATCAGGAGGCTGGGCTGGAATGACAGCG CAGCGGGGCCTGAAACTATTTATATCCCAAAGCTCCTCTCAGATAAACACAAATGACTGC GTTCTGCCTGCACTCGGGCTATTGCGAGGACAGAGAGCTGGTGCTCCATTGGCGTGAAGT CTCCAGGGCCAGAAGGGGCCTTTGTCGCTTCCTCACAAGGCACAAGTTCCCCTTCTGCTT CCCCGAGAAAGGTTTGGTAGGGGTGGTGGTTTAGTGCCTATAGAACAAGGCATTTCGCTT CCTAGACGGTGAAATGAAAGGGAAAAAAAGGACACCTAATCTCCTACAAATGGTCTTTAG TAAAGGAACCGTGTCTAAGCGCTAAGAACTGCGCAAAGTATAAATTATCAGCCGGAACGA GCAAACAGACGGAGTTTTAAAAGATAAATACGCATTTTTTTCCGCCGTAGCTCCCAGGCC AGCATTCCTGTGGGAAGCAAGTGGAAACCCTATAGCGCTCTCGCAGTTAGGAAGGAGGGG TGGGGCTGTCCCTGGATTTCTTCTCGGTCTCTGCAGAGACAATCCAGAGGGAGACAGTGG ATTCACTGCCCCCAATGCTTCTAAAACGGGGAGACAAAACAAAAAAAAACAAACTTCGGG TTACCATCGGGGAACAGGACCGACGCCCAGGGCCACCAGCCCAGATCAAACAGCCCGCGT CTCGGCGCTGCGGCTCAGCCCGACACACTCCCGCGCAAGCGCAGCCGCCCCCCCGCCCCG GGGGCCCGCTGACTACCCCACACAGCCTCCGCCGCGCCCTCGGCGGGCTCAGGTGGCTGC GACGCGCTCCGGCCCAGGTGGCGGCCGGCCGCCCAGCCTCCCCGCCTGCTGGCGGGAGAA ACCATCTCCTCTGGCGGGGGTAGGGGCGGAGCTGGCGTCCGCCCACACCGGAAGAGGAAG TCTAAGCGCCGGAAGTGGTGGGCATTCTGGGTAACGAGCTATTTACTTCCTGCGGGTGCA CAGGCTGTGGTCGTCTATCTCCCTGTTGTTC >S2 ACACGCATTCACTAAACATATTTACTATGTGCCAGGCACTGTTCTCAGTGCTGGGGATAT AGCAGTGAAGAAACAGAAACCCTTGCACTCACTGAGCTCATATCTTAGGGTGAGAAACAG TTATTAAGCAAGATCAGGATGGAAAACAGATGGTACGGTAGTGTGAAATGCTAAAGAGAA AAATAACTACGGAAAAGGGATAGGAAGTGTGTGTATCGCAGTTGACTTATTTGTTCGCGT TGTTTACCTGCGTTCTGTCTGCATCTCCCACTAAACTGTAAGCTCTACATCTCCCATCTG TCTTATTTACCAATGCCAACCGGGGCTCAGCGCAGCGCCTGACACACAGCAGGCAGCTGA CAGACAGGTGTTGAGCAAGGAGCAAAGGCGCATCTTCATTGCTCTGTCCTTGCTTCTAGG AGGCGAATTGGGAAATCCAGAGGGAAAGGAAAAGCGAGGAAAGTGGCTCGCTTTTGGCGC TGGGGAAGAGGTGTACAGTGAGCAGTCACGCTCAGAGCTGGCTTGGGGGACACTCTCACG CTCAGGAGAGGGACAGAGCGACAGAGGCGCTCGCAGCAGCGCGCTGTACAGGTGCAACAG CTTAGGCATTTCTATCCCTATTTTTACAGCGAGGGACACTGGGCCTCAGAAAGGGAAGTG CCTTCCCAAGCTCCAACTGCTCATAAGCAGTCAACCTTGTCTAAGTCCAGGTCTGAAGTC CTGGAGCGATTCTCCACCCACCACGACCACTCACCTACTCGCCTGCGCTTCACCTCACGT GAGGATTTTCCAGGTTCCTCCCAGTCTCTGGGTAGGCGGGGAGCGCTTAGCAGGTATCAC CTATAAGAAAATGAGAATGGGTTGGGGGCCGGTGCAAGACAAGAATATCCTGACTGTGAT TGGTTGAATTGGCTGCCATTCCCAAAACGAGCTTTGGCGCCCGGTCTCATTCGTTCCCAG CAGGCCCTGCGCGCGGCAACATGGCGGGGTCCAGGTGGAGGTCTTGAGGCTATCAGATCG GTATGGCATTGGCGTCCGGGCCCGCAAGGCG . . . . I … Software Development python | |
I am desperately needing the assistance of people who understand VB and issues with programs written and compiled by incompetent programmers (me). Desperation compels me to throw myself on the mercy of the VB community of people who know what they are doing in the world of code writing; desperation … Software Development visual-basic | |
Write an application that computes the cost of a telephone call. The inputs are the time the call was placed (this should be written as a 24-hour time, e.g., 2149 for a call placed a 9:49p.m.), the duration of the call in minutes, and the distance in miles of the … Software Development java | |
So i was busy playing around with the python module MySQLdb and looking at sql injection. [CODE] import MySQLdb def hack(name): db=MySQLdb.connect('xxx','xxx','xxx','xxx') cursor=db.cursor() sql="SELECT * FROM PLAYERS WHERE NAME = %s" %(name) print sql cursor.execute(sql) print cursor.fetchall() [/CODE] i entered Hack("'pete' OR '1'='1'") results were: SELECT * FROM PLAYERS WHERE … | |
Hello! I'm doing my first homework assignment with abstract classes and interfaces. I have a few questions: (1) I know that a class must be saved on the computer as, for example, Class.java. Is this the same for abstract classes? How are interfaces supposed to be saved? Do they need … Software Development java user-interface | |
1. (10 points) Using string method find, extract the Video link from the following HTML code for embedding videos on a web page. Your code should work for any embedded code of this format. <embed src="http://www.youtube.com/v/Xp2uzv9uSn8?version=3&feature=pl ayer_detailpage" type="application/x-shockwave-flash" allowfullscreen="true" allowScriptAccess="always" width="640" height="360"> 2. (10 points) In the Disney cartoon adaptation … | |
can a stack act as a queu or does it has to be last in first out? i am trying to make a program, using Huffman`s compression theory, and i am using stack, while its explained using a queu...i want to know if this can be done... thanks in advance … Software Development c++ | |
I have a question for all of my fellow Daniwebbers. If I place a panel within another panel, can I "click" the panel later? In other words, if I am able to click the panel, can I reference that panel in code for manipulation? Such as flipping or rotating the … Software Development vb.net | |
Hello Everyone I have an Internal frame in my application which has a JTable populated with values from a database and a JButton which performs some operation when a row is selected from the JTable.When the user does not select a row from the JTable and clicks the JButton, I … Software Development java java-swing pdf | |
Is there a method to check if a JButton has an Icon? becouse I've been searching all over google and i cant seem to find anything Software Development java | |
Hi everybody, Is it possible to run c++ console apps in webpages ? I know that its not possible, but is there a way to do that ? Thanks. | |
Hey guys, I'm currently creating an Employee style GUI program in Java, and I have a .txt file with several Employee details (int, string, string, string, int, double), right now I want to implement a way to display all objects within a JComboBox at the very bottom of my program. … Software Development gui java java-swing | |
Hi, I was wonder if someone could give me some help with my program I have a variable: char *insert = "abcdefgh" and i want to split that into chars like so, 'a', 'b', 'c', 'd', etc. I've tried ToCharArray(), but that doesnt seem to work Software Development c | |
I am trying to implement my own version of BigInteger which can hold an arbitrary big integer. I have posted my BigInteger.h file here and I need your suggestions if there is any better design for this. 1. std::string private member will hold the BigInteger in the form of string. … Software Development c++ file-stream | |
Please give me ideas why would I get following errors: [code] Traceback (most recent call last): File "C:\temp_Jag\FilePickling.py", line 3, in <module> unpickledlist = pickle.load(unpicklefile) File "C:\Python26\lib\pickle.py", line 1370, in load return Unpickler(file).load() File "C:\Python26\lib\pickle.py", line 858, in load dispatch[key](self) File "C:\Python26\lib\pickle.py", line 1142, in load_pop_mark k = self.marker() File … Software Development python | |
void swap(int *x,int *y) { static int *temp; temp=x; x=y; y=temp; } void printab() { static int i,a=-3,b=-6; i=0; while(i<=4) { if((i++)%2==1) continue; a=a+i; b=b+i; } swap(&a,&b); printf("a=%d b=%d out side rec\n",a,b); } main() { printab(); printf("end of output 1"); printab(); } out put for the first printab() is 6 … Software Development c++ | |
i need help in adding image in my current payroll project i need a more simple way or easier to understand codes in adding image in my database tnx in advance Software Development image microsoft-access vb.net | |
Okay, So I have an application which uses MSSQL server as datasource. Is there anyways I can avoid using any database server and use a local file as datasource ? If yes , what are options. AND HOW ? PS: this is very important guys. please help. THANK YOU. | |
#include <iostream> #include <conio.h> using namespace std; int counter=1; int m=1; int n,j,o; int main() { for (n=9;n>=1;n--) { for (j=5;j>=counter;j--) { cout<<"*"; } if(counter>5) { for (o=0;o<=m;o++) { cout<<"*"; } m++; } counter++; cout<<endl; } getch(); } my problem is, i need to enter number to get that output, … Software Development c++ | |
Hi, everybody. I am reviewing some old code and two questions came to mind. 1) Is it better to use “[B]\n[/B]” or [B]endl[/B]? [INDENT]"[B]\n[/B]" seems to be working just fine, but most code samples I see in books nowadays use [B]endl[/B]. What is the difference?[/INDENT] 2) For multi-line output statements, … | |
Hello. I am trying to use the strtok function to separate individual words and store them in a 2D char array. However, only the first word is stored in the 2D array. [CODE]cout << "Enter a string: "; cin.getline (str, MAX); //count number to words char *p = strtok (str, … Software Development c++ | |
[CODE]#ifndef PARTICLE_H #define PARTICLE_H #include<vector> #include<iostream> using namespace std; class Particle { protected: public: Particle(); Particle(const int aDim); int dimension; vector<double> velocity; vector<double> position; vector<double> pBest; double pBestFitness; double fitness; bool valid; bool operator<(const Particle& aP2) const; ~Particle(void); }; #endif[/CODE] [CODE]#define SWARM_H #include"Particle.h" #include<vector> #include <Algorithm> #include<iostream> #include<stdexcept> using namespace … | |
i am calculating some expressions and the result of these expressions is a DOUBLE type value , i am storing this result into a double type variable called Sum . now i want to write this value of Sum into the Edit Control of a Dialog Based MFC application . … |
The End.