64,152 Solved Topics
Remove Filter  | |
| | Hi, I'm new to Perl but I'd like to know more. For this purpose I downloaded the ActivePerl-5.10.0.104-MsWin32 .msi package and installed it on my computer OS XP Home. Xitami, PHP, MySQL were already installed, and PHP can connect to MySQL. Now I run the following code from the command …  |
| | I have a TicTacToe board and I need to draw a line through the X's or O's when someone wins. I know how to use the paint method, repaint, etc (as far as how they're called & the basics). I'm just not sure how to go about actually drawing the … |
| | I program using Win32 API's. I compile with Borland or Microsoft "CL". I am on an XP machine. I use .cpp extensions to compile so C++ rules apply. I'm trying to get the bytes from my screen and send them to a disk file. I get a handle I call … |
| | I have this program and I have made the changes. Now I am trying to implement the stack within my code and im confused. I need to push the environment_types onto the stack but I dont know how. Here is what I have [code=syntax]int X=0, Y=0, Z=0 ; /* Evironment … |
 | hi all, how to display last 10 record form a table.please help me. |
| | I have 1 line in this code that I can't get to compile. I'm new to C++ and begging for some help...any advise would be appreciated. [code] #include <iostream> #include <iomanip> using namespace std; double population(double pop, double birthRate, double deathRate); void printPopulations( double startPop, double birthRate, double deathRate, int … |
| | Hello again guys! i have a simple question how to promt user to enter a number for example 444 or whatever and for c to print it as a 9 digit number, so if its 444 c would print it as 000000444? any help would be greatly appriciated., thanx! |
| | plz i need urgent help i hav to giv project of web , a dynamic website using php.. gimme sum gud idea for topic plzzzz  |
| | I'm a newbie at posting code so I'm sorry if I make any mistakes. The 26 line won't let me compile and I don't understand why. can anyone help me??? [code=cplusplus] #include <iostream> #include <iomanip> using namespace std; double population(double pop, double birthRate, double deathRate); void printPopulations( double startPop, double … |
| | I'm having trouble implementing isalpha in the correct spot. When I put it in the if statement, it doesn't determine the palindrome correctly. It says everything I entered is a palindrome. Then I try to implement it with the int k, but then it gave me "parse error before +," … |
| | I can't get it to compile. Here are the instructions for the assignment: Write a program that determines which of a company’s four divisions (Northeast, Southeast, Northwest, and Southwest) had the greatest sales for a quarter. It should include the following two functions, which are called by main. • double … |
| | I can add a new node if the head is empty, but I can't attach a new node. Instead I get a null pointer error. Can anyone see what I'm doing wrong. I think I've been staring at this for too long. EDIT: Forgot to say I'm adding the Nodes … |
| | Okay i need this quick please i am kind of stuck basically i have got to find the highest and lowest numbers out of four integers. Is there a function in java.math or do i need to make one using a loop maybe? |
| | I have the following GUI code but my JLabel for results doesn't work when either of the buttons are pushed [code] import java.awt.*; import java.awt.event.*; import javax.swing.*; public class TempConverterPanel extends JPanel { private JLabel input, results; private JButton output_f, output_c; private JTextField temp, fahrenheit, celsius; public TempConverterPanel() { setLayout … |
| | Hai there, I would like to ask about currency format in Bash script let say i have $US2550000, after format it, it become $US2.550.000,00 Thanks for the help |
 | Hi all, Can anybody help me out with the connectionstring for connecting VB6 to a Microsoft SQL Server 2005 Express Edition. I have tried several documented varieties which do not work. My latest attempt was a version from [URL="http://msdn.microsoft.com/en-us/library/bb264566(SQL.90).aspx"]this website[/URL]. I downloaded the application and associated files and changed the … |
| | I'm fairly new to making GUI's in tk so I downloaded activestates GUI builder from sourceforge. It has a very straightforward drag and drop interface and is easy to pick up. However I ran into a problem trying to edit the widgets it creates. It makes 2 files, the first … |
| | I ve to Write a Python program that prints a random DNA sequence in Fasta format. That program should ask for the length of the sequence and suggest a reasonable sequence name. The session should look something like: > python randomdna.py Length: 34 >MySequence TGCGCATATTGTCTAACTATGGCTGTGGCCGGA The output must be in … |
| | Hi, I want to use outputs from different forms of a project and save them into a single text file that could be from a module. Please suggest any tips on this. Abhishek |
| | hi all, if you look at the code below you will see that i am trying to get a template function to return an iterator based on the type type of one of its parameters, i cant seem to get it to work i dont want to have to pass … |
 | Hi Folks, is there a way to validate input fields using only PHP scripts before inserting into a MySQL database? I have fileds for: Date (DD-MM-YYYY) Time (24 hour format between 0900 and 1700) Location (String) Your suggestions will be a boost. |
| | I need a little help converting my GUI panel into JButtons instead of text for some parts [code] //Davina Moore //TempConverterPanel //November 6, 2008 import java.awt.*; import java.awt.event.*; import javax.swing.*; public class TempConverterPanel extends JPanel { private JLabel input, results_f, results_c; private JButton output; private JTextField fahrenheit, celsius; public TempConverterPanel() … |
| | Hi. I just joined this forum because I really need some quick advice on a Blackjack game I'm working on. It's my first major endeavor, and I can't quite get it to work right. Here's the code. #blackjack.py from cards import * from graphics import * import random DIM = …  |
| | Hi Everyone! I have to make a forum with MS SQL, and, as I'm Hungarian, we use characters, like áéíőúű, etc. Now, if I insert a text with the letter ő or ű, I get back o and u. How can I solve this problem? The users write posts in … |
| | Hey Guys., Im super desparate have 1 day to hand this in. Have to use loops only. quote: The use of any of the following C statements or functions is not permitted under any circumstances. break; continue; exit(); abort(); No global variables. When the program starts it will prompt the …  |
| | Hello, I have just started using Delphi and ran into a small problem. It's a simple app, as I am only practicing. It has a Button and 2 Edit boxes. I want the user to enter some text to be saved (in a .txt file) in Edit1 and choose a … |
| | [code=csharp] using System; /// <summary> /// Summary description for Class1 /// </summary> interface I { void dis(); } class B:I { public virtual void dis() { Console.WriteLine("dis() in Base"); } } class D : B { public override void dis() { Console.WriteLine("dis() in Derived"); } } class c2 { public … |
| | Hi, I have 2 things I'd like help with: 1) is there a way to find the exact center of my screen? 2) a loop Here's what I need the loop for: [code] image = ImageGrab.grab((0,0,800,800)) box = (100,100,400,400) im = image.crop(box) im1 = im.save("screen.jpg") # at this point I … |
 | after you switch (variable) case 1: etc.... if the switch defaults, how do you return to repeat the switch case? do you just do a simple cin>>var and it will reset or you have to loop it? Sorry if question isnt clear |
| | Consider d_type=POINT_LONG in the following program. and data.Long=0xA; In the following program i am getting correct output in constDataArea[0],constDataArea[1],constDataArea[2], constDataArea[3] which is oxA, 0x0, 0x0, 0x0. But not able to write the same into ambi.dat file. Some junk value is inserting in the front. and writing 5 bytes instead of … |
 | Please help me find the sine series . My program is: [code] #include<stdio.h> #include<conio.h> #include<math.h> float facto(int a); int main() { int n,g,k,y; y=1; float s=0.0; float f=0.0; float l =0.0; float x; int t=0; printf(" limit is \n"); scanf("%d",&n); printf(" no. is \n"); scanf("%d",&x); x=3.14*(x/180.0); while(y<(n+1)) { g=y; if(g%2==0) … |
| | >>> line = '2008-10-27 12:05:54........... >>> time = line.split(' ')[1].split('.')[0] >>> print time 12:05:54 i would like to add 45 or so minutes to the time i am parsing from a line i have tried print time.timedelta(minutes=45) Traceback (most recent call last): File "<pyshell#44>", line 1, in <module> print time.timedelta(minutes=45) … |
| | Hi guys, i have a ksh script that gets some info on processes and puts it into a temp file: [code] /usr/ucb/ps -auxxx|awk '{print $3," "$4," "$2," "$1," "$11}'|grep -v 0.0|sed 1d > $TMP [/code] It gets the following data [code] 0.8 6.2158230724046144 9918 oracle 0.3 6.2158200964043168 15298 oracle 0.2 …  |
| | Hi All, I am sure having problems with reading from a sequential file. I created a .txt file and placed it several places within the vb.net file folder for the program that I am writing. The problem is that when I try and run the program I get the message … |
| | Hi guys, I have a media player that opens its own window and works fine with Firefox but it's not working for internet explorer. Been trying for ages and lots of different suppose solutions but still no go. The only thing that happens when you click the link is, bottom … |
| | I am trying to write a simple program to calculate income taxes owed based on gross wages that are input by a user. The HTML page needs to accept the input (wages from 4 users) at once and then utilize a button to submit the information to an external javascript … |
| | i need to write a c++ function that could read in the values of a text file, but in the text file we need to eliminate duplicate values; for example we may have values like ;;;; this is a text file, and it contains the above students, there first name … |
| | |
| | hi, i want to disable the parent window when i opened the child window using javascript and html. i have written code like this.but its working only one time.any one knows pls help me in this situation. s.html <html> <head> <SCRIPT > function popuponclick() { my_window = window.open("p.html", "mySelect", "status=1,width=750,height=450,resizable=no"); … |
| | hi all, i made two commbox in my page cropcat,subcat.my coding is below.when i select a item form cropcat related subcat fetch from database mysql and displayed.but my problem here is that when i select item form cropcat page refresh and selected value not display in cropcat ?please help me …  |
| | Hiiiiiiiiiiiiiiiii :) I want to create crystal report filtered with specific values Iam creating the report with wizard... if i filter just one filed then every thing goes fine, put if i filter more than one filed i got the following error when run: Error in File C:\Users\kisruser\AppData\Local\Temp\test {8D5AD4DD-CCD0-451E-BF1F-7E3E31F22880}.rpt: Error … |
 | This is for a school project: write a GUI application that will generate multiple 3 digit numbers and count how many times each 3 digit number appears. To make the program more useful, provide the following: A label that displays the 10 most common 3 digit numbers and the number … |
| | Hello, I am working on small program that reads in a string consisting of minimum two words and a space between them. My dilemma is that i keep getting an error message. Can anyone twlm me what it is that i a ding wrong? here is my code: [CODE] #include …  |
| | Hi All, I am using the following code to populate a tree control. The dictionary currently I am using is ‘dictFolders’ and its structure is defined below. lstFolders=[] lstFolders = ["A","B","C","D"] dictFolders={} dictFolders = {"A":["Obj1","Obj2","Obj3","Obj4","Obj5","Obj6","Obj7","Obj8","Obj9"], "B":["Doc1","Doc2","Doc3","Doc4","Doc5","Doc6","Doc7","Doc8","Doc9"], "C":["Link1","Link2","Link3","Link4","Link5","Link6"], "D":["Obj1","Obj2","Obj3","Obj4","Obj5","Obj6","Obj7"]} # Setting the root node text to the Action ID entered self.treeAction.SetItemText(self.treeAction.GetRootItem(),”Parent … |
| | Howdy all, New here. And I've done a search. Just can't find what I'm looking for. I have a number in some text that I want to increment every week by 100 . And, i need it done automagically. I have thought initially of putting the number in a DB … |
| | Hey Guys! I have a weired one here, it must be a post-test loop, and here is how result has to look like: Enter the Section Code: 0 Invalid value entered. Must be 1 to 4, please re-enter: 1 Enter the Student's ID: 456789 Enter mark#1: 10 Enter mark#2: -20 … |
 | I'm trying to make this program work like a game of BlackJack. However, the program will not listen to me when I try to end the loop. does anyone have any sugestions on how to fix this program? [code] #include <iostream> #include <ctime> using namespace std; double card = 0; … |
| | what are available database management systems to use with c applications?  |
| | My procedure works perfectly when there is another instance of my program running but otherwise it gets stuck in a constant loop. I've tryed all sorts and came here as a last resort. There's not really much else I can say so here's my code: [code] {*Finds and ends previous … |
| | hi there i'm new here i hope you can help me through this homework i've read like 14 pages of topics about seekg and fstream.. and well.. they didn't solve my problem. my homework it's about creating a text file from "b to z" without the vocals, then reopen the … |
The End.