2,977 Topics
 | |
| | basically i am trying to search for similar strings in an array which is hardcoded into the script and compare them to and find the line they exist on the text file here is my code so far [CODE=perl] #!/usr/bin/perl %fruit=(banana=>1,apple=>2,orange=>5); $target = %fruit; open(INPUT, "<fruits.txt"); while (<INPUT>) { if …  |
 | I'm focusing now on this I/O thing, even writing a guide by looking some sources. I want to cover it all i can about stdin i/o and if it looks good in the end i'd love to share with you. But that's still OT. I can't get rid of the … |
| | Hi, I have strings like this: [code] $string="OWN - NLM STAT- Publisher DA - 20091005 AU - Gannon AM AU - Turner EC AU - Reid HM AU - Kinsella BT AU- XYZ AD - UCD School of Biomolecular and Biomedical Sciences"; [/code] I want to parse these tags and … |
| | Hallo everyone im starting to learn perl and i have a problem , i have an exercise asking me to count all the letters each apart in a DNA string , for example my @DNA =( ctagctagcatgacgatacatgacagataggatacagatagacagatacagatacagatacagatagacccatgacagatac) so i have to make a perl script showing the user how many … |
| | Hi all, I am a perl newbie. I am using a perl code to read a column full of data from 1 field into an array [CODE]for(my $i=2;$i<table->last_record;$i++) my @data = $table->get_record($i,"Date"); [/CODE] Now for example if my @data[1] consists of list of numbers, I need to find the diff … |
| | Hi Guys: I am trying to build a simple application to query a REST web service. I have developed a perl script and its working fine. I have also developed a java app which does the same thing. Just wondering if C++ can be used for it. I did not … |
| | I had another thread before this one, but I felt that it was getting too long. Current problem: My operator== is not working properly in my program. I have done some things in my function, but I don't think it is "completely right". My program compiles fine and the output … |
| | Hello friends , I need to parse some data from a file and arrange it in a certain file..however the file is so confusing and has such minute issues that it has really confused me now..can sumbody help. Thanks Aj I am attaching the main part of the input file … |
| | I have the script updating everything else in my table with no issues at all, but when I go to update the image it never updates the image, but replaces the current image with the image that is only supposed to show if there is no image uploaded to begin … |
| | Hi I need some help to get this done using php: 1 - I have few hyperlinks say 500 in format like: [code=html]<a href="http://domaina.com/1.html" target="_blank">http://domaina.com/1.html</a> <a href="http://domainb.com/1.html" target="_blank">http://domainb.com/1.html</a> <a href="http://domainc.com/21.html" target="_blank">http://domainc.com/21.html</a> <a href="http://domaind.com/new.php" target="_blank">http://domaind.com/new.php</a>[/code] etc etc Now I want to convert them into format like: [code=html]<a href="http://domaina.com/1.html" target="_blank">keyword 1</a> <a … |
| | I have created the code to connect to a MySQL database and retrieve the values of a table. This is the function for printing the table: [CODE] # Name: dbHistory # Purpose: prints srvHistory table from database # Parameters: N/A # Returns: N/A # This is the implementation of the … |
 | I'm trying to bypass a script if possible to use only a hyperlink that i can build from a database to pull up a web page. What I have is addresses that I need to open in this website: [url]http://gisims2.miamidade.gov/myhome/propmap.asp[/url] You'll notice on the left hand side of the page … |
| | Hi, I have to develop a software and it should run on windows, mac and linux, so i was thinking of developing it in java using netbeans :-/ I have windows OS, would the jar file generated in windows run properly on mac and linux? and is there any specific … |
| | Hi, This is my perl program.......... [CODE]#!c:/perl/bin/perl use CGI qw(:all); $pfaccode=param('faccode'); $pprogramme=param('programme'); $pdeptcode=param('deptcode'); $pbrancode=param('brancode'); $psemester=param('semester'); $pkook = cookie(-name=>'logtime'); print "Content-type: text/html\n\n"; print "<body bgcolor=\"#ffcccc\">"; use DBI; my $dbh = DBI->connect("DBI:ODBC:wwwdsn","webid","dibew") or die "Cant connect: $DBI::errstr\n"; my $sth = $dbh->prepare("select kid from facltmst where faccode = ?") or die "Can not … |
| | [B]This is css code[/B] [code=css]*{ padding:0px; margin:0px;font-size:100% } html{ font-size:100%; height:100%; } body { background:#8b909c url('../images/page-bg.gif') repeat-x; height:100%; font-family:"Trebuchet MS", Verdana, Arial, Helvetica, sans-serif; } a{ text-decoration:none; color:#00a8cc; } a:hover{ text-decoration:underline; color:#00a8cc; } p{ font: 0.9em/1.2em "Trebuchet MS", Verdana, Arial, Helvetica, sans-serif; } h1{ font: 1.5em/1.5em "Trebuchet MS", Verdana, Arial, … |
| | Hello! Good morning. I am a newbie to perl. Sorry for the "stupid" question. Need your help on a perl one liner. Can't figure out how to add into the line. Currently have the following line: perl -pi -e 's='\{"$Poly_Map"=\{"$Poly_Map"F= temp_list This to search something like: A1_0 {A1_0 size by … |
| | Helllo all, well I am trying to split a file on the basis of space first and then trying to join it with "-" but i am not able to do it, can sumone please suggest what should I do in order to do it. I am attaching the required … |
| | I have a txt file as an input. It is a list which looks like this: [COLOR="Red"]A12345 B153875 C34893 ... ...[/COLOR] and I have a database file which looks like this: [COLOR="Green"]A12345 detail information nvonafwenfovosdncsjdnfoewhuwerhwieufhiudhfisdfnsd sdofnowerugfeuhgfurhgiuwerhfjdshfiasdhifheruwufhi irgfiweurgf A246 detail information isdofnowerugfeuhgfurhgiuwerhfjdshfiadhifheruwufhi wgerjgneiguihuhdnvkjdnvkjbdegiauberiubgieubgridfb ooogrngoawerngiauengugbuivrug B153875 detail information wgerjgneiguihuvkwwjddnvkegtiaugberijubgieubgridfb eragnowergnoweungfiousdhiuhsdnjkfnsk C34893 detail … |
| | Hi, Well I am getting this warning while running my script which is attached:Use of uninitialized value in concatenation (.) or string at aj.pl in this line : print OUTFILE"$address[$k]|" as when i remove this line I don't get any warnings: Can someone please tell me what is wrong with … |
| | Running Ubuntu Intrepid. Installed Dansguardian recently. When I try to start or restart dansguardian, I get the following error: [CODE]micah@micah-ubulaptop:~$ dansguardian Unable to getgrnam(): Success[/CODE] I know this has something to do with the group in my dansguardian.conf file. The only thing I can see that relates to that is … |
 | Well, I want to have a program make a graph from the data that it has, so I looked up how to do that in Perl. The GD::Graph module came up. The problem is, that I tried installing GD previously and it did not work. I have tried every trick … |
| | This is actually a CGI issue I am having but Perl seems to be the closest forum here. I am having a very simple (hence very frustrating) problem with a CGI/Perl script. For some reason if I pas things from a checkbox they all get passed fine but the last … |
| | having this problem for first time. Keyboard keys not responding properly. Its not typing the wrong words. But actually opens up different windows with different keys. Like with "R" it will open "RUN" command dilog box and with "F" opens SEARCH. And then suddenly START will flash and keyboard will …  |
| | Hi all ! Can anybody tell me why the following code is not copying the file from source to destination? Thakns in advance........ use File::Copy; my $source="C:\\shared\\8.4.1\\DXSI"; my $dest="C:\\r45"; my @files; my $file; opendir(DIR, $source) or die "can't opendir $source: $! \n"; @files=readdir(DIR); close DIR; foreach $file(@files) { print "\n … |
| | I am migrating scripts from UNIX server to a Linux. In the perl script it calls rcp to transfer files. It worked ok in UNIX but not in Linux, which has scp, I dont want to do scp now as this is a temporary Linux Box I am using. I … |
| | Hello, I have a program, let's say foo.cpp . If I do "g++ -S foo.cpp". That generates the file "foo.S" with assembly code. I would like to compare the assembly code foo.S with the assembly code generated if I put foo.S in a c program (even though there should be …  |
| | a little introduction of my self :) Name: Hamzalija (mostly known as hami) Nickname: Claw, meco or hmeco Height: 6'10'' Weight: 300 (give or take few love handles :P) Hair: black Eyes: Brown Location: DK (Denmark - Europe) Age: 23 Hobbies: running my business, world of warcraft (addict :P), software … |
 | Hi, I am used to array of hashes in perl. So I was trying to do something like that in c++. Suppose I have created an array and now I want to store multimap in it. How can I do that ? I need to get some clues about this. … |
| | Hi, I'm a newbie in Perl programming. I have to start/stop the Windows services running on the remote machine. So, I’m writing a script in Perl to accomplish this job. So far, I’ have completed the following tasks. • to access the windows services through Perl in my local machine. …  |
| | Hello all. I was trying to execute wget from the perl under windows vista. In cmd i can easily run wget because its in \windows\system32 folder. But from perl,when i try both system('wget --h'); and system('c:\windows\system32\wget --h'); i get the next error : 'wget' is not recognized as an internal … |
| | Hi all, Can anybody tell me, how to coy a directory along with its contents from remote machine to my local location? Both the machines are windows only. Thanks in advance. |
| | Hi all, I am new to Perl. I am trying to send a variable which contains the location of my executable (eg: C:\temp) to system function. i initialized the variable as, my var1="C:\\temp"; when i print this line i got : C:\temp as o/p. To start the executable i did: … |
 | Hey! so i guess I'll start out by saying HI! :) i found this doodad at the top and so I thought I should fill one out! Hope to get to know lots of you and hope we can help each other! Name: Michele Nickname: Shely Hair: Brown Eyes: Blue … |
| | Hi! I'm having some problem in displaying long varchar retrieved from database on the interface. When the text is very long, it causes the interface to stretch horizontally to display the whole text. I've tried to use text field to display them. It can restrict the display of text in … |
| | I have a program that outputs bugs fixed on given dates. I am going to graph this in excel, but I want to center the graph at the release date so I can see the change of bugs fixed before release and after. To do this, I need the x-axis … |
| | A protein entry on swissprot database be something like this: ID ATF6A_HUMAN AC P18850; O15139; Q5VW62; Q6IPB5; Q9UEC9; DT 01-NOV-1990, integrated into UniProtKB/Swiss-Prot. DE AltName: Full=Activating transcription factor 6 alpha; DE Short=ATF6-alpha; OS Homo sapiens (Human). RN [10] RP REVIEW. RX MEDLINE=21376119; PubMed=11483355; DOI=10.1016/S0378-1119(01)00551-0; RA Hai T., Hartman M.G.; RT … |
| | hello, i echo this [CODE] echo "<td ALIGN='center'><div class='rollover'><a href='http://www.tsfdgdg.com/search.php?search=$stackname' style='text-decoration: none';> <table border='0' celpadding='0' cellspacing='0' id=\"point\"> <tr> <td width='100px' height='101px' ALIGN='center'> <font size=3 font face=Arial font color=white><b>$stackname</font><br><font color=orange font size=2>$posted</font></b> </td> </tr> </table></a></div> </td>"; [/CODE] here is the css code [CODE]<style type="text/css"> .rollover a { float: left; width: 101px; …  |
| | Could you suggest how to prevent the following script from reloading when 'Submit' is pressed ? Thanks [code=perl] #!/usr/bin/perl use strict; use warnings; use CGI qw(:standard :html3); our @results; #require ("file_upload2.pl"); print header; start_html(' questions shuffle'), print h2 ("\t questions shuffle"); my @questionsets = ("dt_questions.txt", "questions2.txt", "dt_questions.txt"); foreach my $setfile … |
| | how do i do a hyperlink to last page? this is a page url.. e.g. [url]http://www.ufaffd.com/topic.php?id=44?topic=&page=2[/url] how do i do a hyperlink to last page not specific page.. |
| | For quite some time, I have been unable to get streaming videos to play properly. This occurs with Youtube, Hulu, and related sites. I hear the audio fine, but what I see is basically a slide show of images. I've done speed tests on my computer (using speedtest.net) as well …  |
 | I've just started using Delphi and right away there's one thing I can't do in a VCL forms application: destroy it properly. At the moment I'm calling Form1.Destroy which appears to work, but if I look at the processes list it's still there and Delphi refuses to write the .exe … |
| | Hi, I have done a lot of regex in perl and feel like in no mans land in c++ :) Well I want to parse a tab delimited file and want to print specific fields as per my needs. One more thing the input file may not be sorted and … |
| | Every time I run certain programs (Microsoft Reader, Pando 0.9.3) I receive the following error: The application failed to initialize properly (0xc0000005). Click on OK to terminate the application. I then click OK only to be presented with the same error message, but this one actually goes away when I …  |
| | Hi, I am creating list in SharePoint and I want the list to have various Hyperlink columns. the problem that I have is that SharePoint will only allow me to create 8 or so columns of the data type 'hyperlink'. Can this be changed? My other question is can you … |
| | I have a windows service (Serv.exe) running as LocalSystem, at a certain point it wants to show the logged-on user that it is processing data, therefore I CreateProcessAsUser(Display.exe) which is a C# Windows Form that display information (this all works perfectly fine). Now, when the Service is finished I want … |
| | I've got a text file in this following format : Field Data 1 2 1 3 1 4 2 5 2 6 3 2 3 3 3 4 I would like to open separate windows for each of the field... meaning : window1 (for field1) will display 2,3,4 window2 (for … |
| | Hi I am struggling learning perl and everytime I try to enter stuff in at runtime I keep getting a 1 returned. I dont get it. please can you explain to me what I am doing wrong. #!/usr/bin/perl print "content-type: text/html \n\n"; &fname; print "\n totals are out of 140 … |
 | Code snippet to generate random passwords. Avoids using confusing characters such as lower case L (l) and the number one (1), the letter 'O' and the number zero. Upper-case alpha characters could be added to the character set if mixed-case passwords are desired. |
| | Hi Guys, Can any one suggest to generate a random number of eight digit. All suggestions are welcomed :) |
| | Hi, I have a minor website that I wish to maintain that I do for gratis (for free). It is for a school. I wish to be able to automate the task of adding links and photos and text body. I already use a css template to maintain the look … |
The End.