199,114 Archived Topics
Remove Filter  | |
| | Hi! I'm currently developing a website and I'd like to rewrite the URLs with htaccess. I've looked up some tutorials on how to do it, but it doesn't seem to work. This is one of the url's : `products.php?sub=997&id=97084&name=Manual-Control` I'd like the link to become: `products/997/97084/Manual-Control` This is my current …  |
| | Here is the code I have in contact.php: <?php mail('philovesdogs@gmail.com','sdf','sadfsad'); echo 'Ok'; ?> I put the echo in just to make sure that PHP was working on the page. I uploaded the page to my LAMP server and opened the page. I saw 'ok'. I checked my email however (and … |
| | I have a problem that I'm sure is a piece of cake for you guys to work out. I have a small index.php script here which creates a php file (with text appended from the index.php script) each time the page is visited. The problem is that I can only … |
| | please help me I'm having error in rs.Open "SELECT * FROM [tbladmin] WHERE [username]= '" & txtUsername.Text & "'", con, adOpenStatic, adLockOptimistic I think my code is right I dunno where I went wrong. Dim strUserName As String, strPassword As String Dim con As New ADODB.Connection Dim rs As New …  |
| | I am having two file (File A and File B) of sequence. In File A, thousand of sequences are in fasta format (For example:>seq1 GGTGTTTGCGTGGTTTCATGAAGGTTTTACTaTCCCGAGGAGCCTCATTAAATTGGCAAGA CTCATTAAATTGGCAAGAGGTGTTTGCGTGGTTTTGGCAAGAGGTGTTTGCGGGTTTTAAA >seq2 CTCATTAAATTGGCAAGAGGTGTTTGCGTGGTTTTGGCAAGAGGTGTTTGCGGGTTTTAAA TTTGCGTGGTTTCATGAAGGTTTTACTaTCCCGAGGAGCCTCATTAAATTGGCAAAAAAAA In File B, Two differnt things are avilable first is the sequence number i.e. >seq1 and its position number 10-120 similarly …  |
| | Could somebody suggest the simplest way forward for me to investigate please? Please take a look at this web page which shows a single record of a mysql db http://www.swaag.org/DB_VIEW_Specific%20Record%20Number2.php?swaagrec=591 I would like to be able to create a program where I can select for example records 1 to 100 … |
| | Hi, I'm not new to SQL or PHP, or basic queries of SQL databases, but I'm creating a site that's going to be dependent on having a really accurate search feature. Basically, I'm just looking for some help on how I can get started, because there's a ton of information … |
| | This is a Simple one Line code for inserting current System date in to a text box: protected void Page_Load(object sender, EventArgs e) { TextBox1.Text = DateTime.Now.ToString("dd/MM/yyyy"); }  |
| | Hi Guys, i have three textboxes the first 2 should only allow users to enter numeric values (0-9) and decimal eg (5.2 , 5.5) the third textbox should allow the first three characters entered to be YUP followed by numeric values only. eg YUP453 or YUP439. Can anyone provide me … |
| | Hello everyone, I have a table called job.In the table two particular columns are empid and managerid.When I am creating the table I must ensure that the managerid should be an existing empid.How do I write the create table statement for this.I am using oracle 10g. Thank you |
 | Hi all, I want to write to html5 application and convert the web application to adnorid application with phone gap. I think I can handle this, I have found many resources for this. but the problem is now I want to enable my native language keyboad when I run my … |
| | Dim MapString(41, 7) As String Private Sub MapForm_Load(sender As System.Object, e As System.EventArgs) Handles MyBase.Load 'mapfile to array Dim StrSplit(), LineRead As String Dim x, y As Integer 'open the file Dim sreReader As StreamReader = New StreamReader("MapFile.txt") 'x and y must be to 0 x = 0 y = …  |
| | Hi guys! I found a source code from the net [Click Here](http://www.sourcecodesworld.com/source/show.asp?ScriptId=1159) about creating an address book. Right now I'm trying to learn how to do it myself by reading diff. samples, the thing is I always see this written in the description and I have no idea how to …  |
 | Hi there, My friend and I are making a game, which is based on a tile engine we are making. The map is loaded into an array of integers to represent each different tile. However, in the map class, we need the variable `data` to hold the integer array so … |
| | this might be a silly question :-) but just for reference asking that System.Drawing.Graphics is a reference type ? or value type ? I mean when creating objects like this Protected Overrides Sub OnPaint(ByVal e As System.Windows.Forms.PaintEventArgs) Dim i As Integer = 10 Dim g As Graphics = Graphics.FromHwnd(Me.Handle) g.DrawString(i, …  |
| | HI.I need advice on the best IDE i can use to code and what are the reasons. Thank you.  |
| | hello friends, could you guide me how i can write my own version of malloc and free function  |
 | help me with a c program that inputs a year number and number of years,then to determine which of those years were leap years |
| | Hi, Other than ajax(), load(), get() and post(), is there way to load part of page content dynamically from another file using jquery? thanks, VC |
| | Hi I Love daniweb for web solution. I want to make a website using jquery. I want to use jquer POST method for my site. My sample code is $.post("search.php",{word:"good"},function(result){ $("#content").html(result); Here the word 'good' will be search in a database using search.php by POST method. I already did that …  |
| | God day! Any body has ha clear and good example on how to use Let and Get function? Thank you!  |
| | Hi, I am trying to develop a android application which is done using html5. I use phongap to convert html5 application to android apk file. Problem is my native lanuage is not supported by android OS yet. In my app I get datafrom database and print them. when I do … |
| | I have been looking for hours on how to do this and haven't found a solution yet, hope someone here can help! Part of my problem is that I'm new to php and web dev, so I don't know what I'm looking for terminology wise. Goal: This is part of … |
| | #include <stdio.h> #include <stdlib.h> int fact(int); int main() { int n,total=1,i; printf("enter the series limit: "); scanf("%d",&n); total=total+n; for(i=2;i<=n;i+=2) { total=total+(pow(n,i)\fact(i)); } printf("%d",total); return 0; } int fact(int c) { int j=1; int facto=1; for(j=1;j<=c;j++) { facto=facto*j; } return facto; } my output should be like this 1+n+n*n\2!+n*n*n*n\4! the error … |
| | Hello .. I wish i don't violate community rules :) I was used to work on the NetBeans IDE Now I am converting to eclipse The problem is that i can't neither create nor find the final executable jar file In NetBeans I just press "clean and build" then the … |
| |  Hi, I have been sitting with this problems for days, I'm not very good with javascript as I am still learning, would really appriciate it if someone could help me. I've got a slidedeck with a number counter which works perfect together, now I'm trying to add another …  |
| | Hello, I've been using Code Blocks as an IDE for a while and decided to switch to VS2010 Professional as I had obtained it throuh Dreamspark. Anyway, I'm terribly confused at the files it gives me for a standard Win32 Console App for C++. Usually, I'm used to seeing: #include … |
 | I am having trouble with this code: <?php // Username $username = $_POST['name']; $email = $_POST['email']; // MYSQL $con = mysql_connect('host','username','password') or die(); mysql_select_db('db', $con); $var = md5($email); $result = mysql_query("UPDATE `table` SET `imageEs`='$var' WHERE user_username='{$_SESSION['sessid']}'") or die(mysql_error()); echo "Profile image updated. <a href='http://www.awsomechat.comuv.com/update_profile.php'>Go back.</a>"; ?> I am trying to … |
| | I am learning C++ and having difficulty getting my code to compile. I get errors while compiling using VS2010, everytime I attempt to fix the errors it seems to cause a snowball effect of compilation failures. Can someone look over the code and maybe give me some hints on how … |
| | I am using AURORAGPT Script When i try to login that time i got warning message (Warning: Cannot modify header information - headers already sent by (output started at /home/dollar/public_html/index.php:7) in /home/dollar/public_html/members/login.php on line 138) here my login.php 138 code line: header("Location: setcookies.php?".iif(isset($returnTo),"view=$returnTo","view=account&ac=main")."".iif("$id","&id=$id").iif($ptype,"&ptype=$ptype").iif($step,"&step=$step")."".iif(isset($ac),"&ac=$ac")."&sid=$sessid&sid2=$sessid2&siduid=$userid"); Anybody please help me to solved this … |
| | we have problem with logout.php page we hav getting error Fatal error: Call to undefined function session_destory() in C:\wamp\www\Project\logout.php on line 4 |
 | So, in an exercise in futility, I decided to write a script that will take either a file or a string and find patterns in the words, and display the results for a nice friendly human use. Right now, it simply searches forwards and backwards(ish), but Im wondering if there …  |
 | Please i need help with this piece of Qt code. It gives a compiled error "**empList' was not declared in this scope**" in the getValue() function. This has got me stucked for a couple of weeks now retarding the pace i'm learning the language. I would gladly appreciate any assistance. …  |
| | Do you need to implement a class in order for an object to access the class's functions/methods? When should you implement a class? When shouldn't you? |
| | i just want to ask if you know a formula, or just VERY SIMPLE codes on how to compute days between two dates? i really don't have an idea on how to make it. thank you! |
| | Hello I have a php script that resides in a single folder I want to run the same script in each folder wihout manually uploading the php file in each file for example I have mysite.com/folder/script.php and folder has different subfolders so I want to create a php file that … |
| | I am having trouble with this code: <?php // Username $username = $_POST['name']; $email = $_POST['email']; $default = "default image"; $size = 40; // MYSQL mysql_connect('host','username','password'); mysql_select_db('database'); $grav_url = "www.gravatar.com/avatar/" . md5( strtolower( trim( $email ) ) ) . "?d=" . urlencode( $default ) . "&s=" . $size; $sql = …  |
| | I am not understanding this at all. I have to have 3 fish swim across the screen in different direction. But I can only get the one fish to swim. I have been looking ont he web and can not find anything that helps me. If someone can help me … |
| | I've been using the HxD hex editor by Mael Horz and recently learned about its ability to display the contents of my entire hard drive(about 1 terabyte). My assumption is that all this data retrieved from the hard drive must be kept in RAM first, and then it can be … |
| | This is the question: Write a program that converts from 24hour notation to 12hour notation.For example, it should convert 14:30 to 2:30 PM. The input is given as two integers. Verifies that a legitimate 24hour notation has been input by using the assert statement Please tell me if my code … |
| | I am newbie in php and i have code for retreving data from the website where the $id=id now i want to retreive the data based on the code Select * from users where cat1=cat1 and cat2=cat2 and also show the data according to the id in decrement order. i …  |
| | Hi, I am pretty new to Joomla. The company i work uses a joomla 1.5 website which was designed before i joined. Now I'm incharge of managing this website by doing some small changes here and there. Problem : There is a page(not index) containing a few images which are … |
 | please help i want to load record in my div id ="msgbox" <div id ="msgbox"> <form action="connection/selectemp.php" method="post"> </form> </div> this is my connection <?php $con = mysql_connect("localhost", "root", ""); if(!$con){ die('Could not connect:' . mysql_error()); } mysql_select_db("intranet", $con); $result = mysql_query("SELECT * FROM `tblmsg` INNER JOIN `employee` ON tblmsg.empid … |
| | Hello, my code is not transferring the selected row data into the targeted text boxes on the other form when i click or select the row, i need help here , that the code Private Sub DataGridView2_CellContentClick(ByVal sender As System.Object, ByVal e As System.Windows.Forms.DataGridViewCellEventArgs) Handles DataGridView2.CellContentClick If Me.DataGridView2.CurrentRow.Selected = True … |
| | Hi guys, i'm new to C#. I have been trying to create a matrix or size 3x3 with the following code: [code] using System; class matrix { static void Main(string[] args) { Console.Write("Enter values for the matrix: "); int [,]matrx=new int[3,3]; for(int i=0;i<3;i++) { for (int j = 0; j … |
| | /* * error on " byte[] m=args[0].getBytes();" error: array index out of bound exception, help me please */ import java.io.*; import java.net.*; import java.io.IOException; import java.net.DatagramPacket; import java.net.DatagramSocket; import java.net.InetAddress; import java.net.SocketException; public class UDPClient { public static void main(String[] args) { System.out.println("client started"); DatagramSocket aSocket = null; try { …  |
| | My understanding of the C language is that the same identifier cannot be reused. However, the code below compiles on GCC without complaints, even when using the "-Wall -pedantic" flags. Is there something that I am missing? Does the standard say anything about functions/macros having the same name as typedef'd … |
| | How can i do scanf's in just one line? because example first i will input a number then i will press enter then the cursor will go to the next line. how can i maintain the cursor in just one line? thank you  |
 |  |
| | How does one who is encountering VB.Net for the first time start. Sandra  |
The End.