199,114 Archived Topics
Remove Filter  | |
| | Hello all I have been wrting a blast script which results in the following error: [code] the small rnas:CAGCGATGGGGATCAAGCTC the sequnce thats being worked is CAGCGATGGGGATCAAGCTC [blastall] WARNING: Unable to open TCV-jagger.fna.nin [blastall] WARNING: : Unable to open TCV-jagger.fna.nin ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: blastall call crashed: 256 /usr/bin/blastall -p … |
| | I have no clue why this isn't working! Basically, I've got my tree and everything working, but now I need to fit it to the input the instructor gave me. What I need to do is read the first part of a line and then input each following term into … |
| | hi, this is a simple program it is not working...please do tell me whether my code is correct [CODE]<form> <?php function login() { print "<script>"; print " window.location='http://www.webs.com/hi.html'"; print "</script>"; } print "<input type='button' name='butt' value='Apply Online' onClick=login() style='height :2em; width :7em; font-weight:bold; font-size:0.7em' >"; ?> </form> [/CODE] |
| | I need some help with <cfquery>, I want to authenticate an add form so the user doesn't enter the same value twice or more so I used recordcount like this [code=ColdFusion]<cfquery name="cool.recordcount" datasource="#Request.proto#"> <cfif cool EQ 0> INSERT INTO proton( name, moon ) VALUES( '#Trim(Form.name)#', '#Trim(Form.moon)#', ) <cfif cool EQ … |
 | Im trying to insert a script <div class="js-kit-comments" permalink=""></div> <script src="http://js-kit.com/comments.js"></script> into my boards profiles page <tr> <td class="row3" valign='top'><b>Country</b></td> <td align='left' class='row1'>Australia</td> </tr> </table> board http://inny.ipbfree.com/index.php? to a particular spot beneath a td (profile field) called 'country' I cant seem to get it to happen. can anyone help? code … |
 | Hi, I am using masterPage wherein i want to blink the text . But i also want to put one logo beside that text. Here i only want to blink the text. I have combined both the logo and text using paint and given the path in masterpage. Please let … |
| | hi, Could anyone send me the source code to insert data into database using javabean?  |
| | Can someone help me?? I recently got an assignment to create a VB Application for DVD Rental(Keeping records and Database). I had some documentation to do these were: Data Flow diagram level 0 and level 1 ERD Decision Tree and Table Data Dictionary Ive completed all except for the level … |
| | I have a collection of (potentially) several hundred thousand image files that I need to generate hash digests for, and I'm unsure of the best algorithm to use. I'll be keying them all to a database based on their hash, so I need the best algorithm for avoiding accidental collisions …  |
| | Hi guys I need to design my project in a UML diagram with a MVC design pattern. The project I am trying to design is a system for KIds that they can store and use thier files within thier MyWorkSpace. They have a musicbox to store music, picture album for … |
| | This is the first time I have ever had to do a simulation type program. This is what I'm trying to do: Your application should use an array of tellers (10 tellers would be a good maximum) but on any particular run of the simulation, any number of tellers from … |
| | I'm trying to create a function that searches through all the beds in a hotel until it finds one that is available or just ends when all the records are searched. When it finds that bed, it updates that bed record with new information (marking it as reserved or occupied). …  |
 | I am confused in tellg funtion can any body tell me its syntax also for seekg();. |
 | is there a way to create a function that uses values from the statement inside of brackets. ex. [CODE=php] myFunction(){ //data here } [/CODE] if not, what i am trying to do is get a html tag and check/modify without having it inside of a variable or echo tag. for … |
| | Hi, I want to use linked list in the linked list. In the following code i would like to introduce new public member as species which has four to five members. How to modify the code to add new member species? In the class TREE, I would like to add …  |
 | Hello, I am having a problem for coping the string into a 2d array.. Also if the length of the string is more than 16 bytes how to continue to read till end of string.. Can anyone help.. [code=c++]int encrypt() { string text = "Encryption"; char b1[4][4]; text.length(); strcpy(text,b1); // …  |
| | I am having trouble figuring this out. I only have one error and it is in main. I am trying to write a program that will output first just a random sudoku type grid(function called random), then I am trying to output a sudoku type grid that has no duplicates … |
| | I'm having a problem maintaining the data in the file. Everytime I enter a person's data the display code I have only displays the first one I entered. I'm not sure if there's somethin wrong with the creating or populating or just the display code I'm using [CODE=c]void addReserve() { … |
| | error message Notice: Undefined variable: sentmail in /home/stud/1/0472547/public_html/send_password.php on line 59 The code works but when wrong email is entered and it cant find it in the database it comes up with that error its all right but for some reason its saying undefined variable // ---------------- SEND MAIL FORM … |
| | 1st off, Im new to C++ programming. I created a function to calculate garage parking charges. I keep getting this last error: HourFee.cpp(65) : error C2065: 'ROW_SIZE' : undeclared identifier this is my error ---> ***int vehicleInfo[ROW_SIZE][COLUMN_SIZE];*** [code=cpp]void calculateCharges() { int x; int r; for (x=1; x<=10; x++) const int … |
| | Hi i have my code that finds every instance of my search criteria in a text file and tells me the position in the text file it is located at. The next step i want to do is stream the bytes that follow each instance of my search criteria into … |
 | Could you have me please?I have made a web browser in visual basic 6.0 and its working well for the most part. I have a several questions. Basing most of my project off of IE7, How do i get my web browser to show the "view source" function of webpage? … |
| | Hi guys, I have an input file as below (it is a family tree): 1 0 0 2 0 0 3 0 0 4 1 2 5 1 2 6 0 0 7 3 4 8 5 6 9 7 8 10 7 8 where column 1 = individual number … |
| | Hello, I'm new to programming and I have a simple project to plot a graph using gwin. The graph should just be a series of circles curving upwards on the y axis, the amount of plots should be defined by the user. I think I have everything almost correct but …  |
| | SO here it is; start with an array that couts random numbers I used the generate function now check those numbers if they repeat so return true if false is returned then you can go onto the next random_integer to check..here I use the contains function the problem is generate … |
| | Hey guys, new poster here. I'm rather desperate here, I just do not understand the concept of templates very well. I've used the search function, but I don't see the problem addressed in any other threads. Any help is much appreciated. My assignment is to create a templated vector class … |
| | Hello, I'm a super newbie at VB and I'm trying to write a very simple math program. The program is supposed to do some arithmetic and display the results, piece of cake. The problem lies in displaying the results. I have no clue how to do it. I went surfing …  |
| | If you read an earlier thread i started i was having completely the opposite problem that i am having now. Before it kept telling me that the table already existed and now it tells me the table does not exist. I have created the table in the db.php page where … |
| | Hi all, I have a problem with Java GUI. How can I set a certain component to be in front of another component or behind it?! i.e. Is there a way to: SendToBack & SendToFront in java?  |
| | Hello, Can any1 tell me how i can change the field/column name on a datagrid only for the web interface. I set the field names for the database with no space in between words but when i display the data on the web page i want it to appear differently. … |
| | Hello everyone, I seem to be having a problem inserting some information into a MySQL table. Below is a copy of the MySQL table code I used and also the PHP code. I was wondering if anyone can help me find out why it wont insert the information. What I … |
 | Hi, is there in PHP a way how to determine in real time geographical area from IP. I mean rough estimation e.g. Asia, USA, Russia etc.? Thanks in advance for any advice! |
| | Hi Friends, I am looking for some Freelancers (only form Mumbai , Thane and New Mumbai) for ASP, ASP.net, php programming.. People interested can contact me thru mail at: <snipped> Regards, Jasvinder Singh |
| | I need help Fixing this I traced through the code, and it compiles not error but when I run the program its just goes crazy I need help finding a the soultion to this problem please Thank you very much [CODE]#include <iostream> #include <fstream> #include <cstdlib> using namespace std; int … |
| | Is it possible to set 4 80x86 processors up each of the registers EAX, EBX, ECX, EDX storing 32 bits of a 256 bit variable? |
| | Hello all, I'm new in this group and with designing databases. I would like to design a databse for managing data about the sports day for a school. I have been able to create the following tables: Pupil(differnt class and age group), Event(hockey, rugby, swimming,relay race), Staff, Equipment(used for the …  |
| | [code=asp]{ bitmap img = new bitmap(fileupload1.posted file .filename); grapics grp = grapics.fromimage(img); grp.smoothingmode=smoothingmode.AntiAlias; grp.drawstring("dani web")new font ("verdananna",20),systembrush.windowtext,2,2); Response.contentType="image/jpeg"; img.save(Response.Ouyputstream,img.Raw Format)); }[/code] By using the above coding i have insert the text to image , but i don't know how to upload that text contain image to database, i want to … |
 | Girlfriend would like to learn about MySQL. Can you recommend any book that purely deal with MySQL? No adds on as PHP or any other web developing technology? I know there are many sites with great tutorials but she insist on book so I have the "pleasure" to find the … |
| | I am banging my head against the wall here. I've tried everything that I can think of to get this to work. [code] class myData { function myStuff($sql){ $result = @mysql_query($sql,$connection) or die(mysql_error()); while ($row = mysql_fetch_array($result)) { $adId = $row['adId']; $adName = $row['adName']; $adData .= "my adId is $adId … |
| | I want to know a small c code to generate random numbers.It could be within a certain range. I want to know if rand() function will generate a random number |
| | Hello, I am having a problem to call a function I am posting the code... Can anyone help how we can solve the problem... [CODE]int AES(string path1, string path2) { ifstream myfile1 (path1, ios::binary);// error ofstream myfile3 (path2, ios::binary);//error } int main() { AES( "c:/plaintext.txt" , "c:/cipheretxt.txt" ); return 0; … |
| | i m working on a small application its main function is to create a album and then add photos in the album. i m using tree view for creating album and photos i m using tree root as album and nodes as photos. i have to also show photos when … |
| | How to Convert Binary String of Length 1024 to its Respective Decimal Number. for example 101 of length 3 and the respective Decimal Number is 5 10111 of length 5 and the respective Decimal Number is 23 like this .. i have a binary number of length upto 1024 ... … |
| | hai to all ...... how to insert watermark in image while uploading the image to database .... that mean ,, the image which i going to save in database have the watermark .... plz reply me as soon as possible.....:) |
| | how to use in [B]onmouseover[/B] and [B]onmouseout[/B] property for a ASP.Net2.0 control by using [B]javascript [/B]Suppose I want to show and hide an Image by taking and removing mouse over another control like Image, Label.... by using [B]JavaScript[/B] only |
| | hello Can anybody tell me how to Write a C program to print "Hello World" with out using ';'  |
| | Greetings, I have this date string that is given to me from somelses code 20080326 and I want to convert it to be MMddYYYY and I get this error: Caught Exception: ValueError:time data did not match format: data=20080326 fmt=%m%d%Y File "/home/gateway/scripts/python/py-allston.egg/main_template.py", line 91, in decorated_main File "db.py", line 24, in … |
| | I have 3 dropdownlist named as dd1,dd2 and dd3. in dd1 i have datas getting from database. then in dd2 bound the data by selecting the dd1 datas... tat coding is ======== [code=asp]protected void dd1_SelectedIndexChanged(object sender, EventArgs e) { string a = "select distinct a.descriptions,a.sid from swift a,pc_link b where … |
| | hi y'all. i just found this site today, but so far, it looks great. anywho, i need a little help. i'm sure it's simple but i'm having a major brain fart. in the part that says 'this_is_where_i_need_the_redirect' i want it to go to a page named invalid.htm. what the heck … |
| | Hello everyone, I need to write code such that: .you can select number of players(2,3or4) and put that number in array.. .display message if correct number not entered. .then each player must be able to choose their color(red, blue, yellow,green) .two players cannot be assigned the same colour This is … |
The End.