Software Development Forum

Hi, I am making a program in which i need to append the file from the beginning. so i am opening the file like this wFile.open("sat.txt",ios::ate| ios::out | ios::in); moving the pointer to the beginning wFile.seekp(0,ios_base::beg); but when i try add data it is overwriting the data. Is there any …

Hello I'm new here my name is Mervin, I'm creating a 3D online game in C# (everything is going well so far don't need to discuss it ;) ) And I am building a TCP server for it in C# (Visual C#.NET) The server needs to be able to handle …

i have two assembly version old version is 1.0.0.1 new version 1.0.0.2 if i want to use old version what should i do? if i want to use new version what should i do? in which field i have to mention in assembly info file ?

can anyone explain me staic vs instance method ..what are the differnce ?

Hi, everyone this is my issue I have to read a binary record from the database and concatenate another string to it, the thing is that is just working one way, I ll put some code to explain better. [ICODE] buffer = rdGetBinary.GetInt32(3);//this is the length of the actual row …

Hi guys, I have a problem. Im trying to read from a file which contains one, two, three, four. The output I get is one two three four But I want to make it read every other line. one three etc. How would I go about that? [CODE] import java.util.Scanner; …

Hello! I recently started learning Python, and I'm trying to install the package GASP ([url]http://pypi.python.org/pypi/gasp/0.4.5[/url]) in order to be able to code some graphics. However, the file is of type EGG. I found that I need to install EasyInstall in order to be able to install EGG files. (The download …

I have made a form that contains about 60 buttoncontrols, 7 panels and 10 textboxes. What happens when I drag around this Form etc.. is that the controls flickers very much. How is it possible to reduce this flickering. Thank you...

Hi, I have this code: [code=python] def yn(input): if input.lower == 'y': return True else: return False def limestone(): I = raw_input("are there shelly fragments? (y/n)") if yn(I): print "Shelly limestone" else: print "chalk" def crystals(): I = raw_input("Are the crystals big?(y/n)") if yn(I): big_crystals() else: print "Basalt" def big_crystals(): …

I'm having a simple problem. I'm using this class to do some stuff with another module. Now, for some reason the self.database and other variables are not able to be accessed by the other methods. I thought _init_ was suppose to work as a constructor, thus the other methods should …

How can I move an ImageIcon in java?

I've always been curious: in VS, and most other IDEs, you are allowed to do something like this: [code=c++] //in file class.h class blah { //prototypes, members, blah, blah blah } //in file class.cpp #include "class.h" //method definitions... etc. //in file main.cpp #include "class.h" int main { //do stuff with …

can any one explain when and how we can use https and ssL IN c# .net..what is the use for it?

can anyone send me the llink for garpage collector working principle..when we use fimalize and when we use dispose method in c# .net plz

How do I search a string for anything? What I mean is, I need to say: [code=python] if line == 'playername = (any name)': temp = line.strip().replace('playername=', '') return temp [/code] Any ideas?

how can i access multiple databases in dataaccess layer to c# .net applications?

Hi I work on a anti-virus programm. The anti-virus program should start when you boot the computer. So I thought it is good to use a HKey to start it always. How can I make such a HKey which starts my program? thx

Hello guys! I just started learning c#.net. I able to make a simple report using crystal report. Now, my problem is I can't include data which comes from the textfields in the forms of my application. ex. I have value "alpe" in my textbox. and I want to include this …

plz help me to set up pdcurses with visual studio 2005.

Hi, Im new to C# and need help with my program that im writing i need to let it read an XML in the first window and when i press add program a second window opens (both windows i have) i want it to write the XML so something like …

I have a form where there are 2 buttons, one which randomly adds buttons onto the form, and one that resets the form to default. When the form is opened there are two buttons, but after clicking the random button, there are many buttons. For the reset button, I currently …

import java.awt.BasicStroke; import java.awt.Color; import java.awt.Dimension; import java.awt.*; import java.sql.*; import java.util.*; import java.util.Date; import java.lang.*; import javax.swing.JApplet; import org.jfree.chart.ChartFactory; import org.jfree.chart.ChartPanel; import org.jfree.chart.JFreeChart; import org.jfree.chart.axis.NumberAxis; import org.jfree.chart.plot.CategoryPlot; import org.jfree.chart.plot.PlotOrientation; import org.jfree.chart.renderer.category.LineAndShapeRenderer; import org.jfree.data.category.CategoryDataset; import org.jfree.data.category.DefaultCategoryDataset; import org.jfree.ui.ApplicationFrame; import org.jfree.ui.RefineryUtilities; //import org.jfree.chart.demo.Time; /** * A simple demonstration application showing how …

) Hi Guys, I am working now in a project that is placed into my docs\visual studio proj, that need to use . h files, placesd in c:\prog files\windows sdk and c:\prog files\OpenCv. Into these directories have another subdirectories with these .h that into them are included others .h files …

what is mean by static constructor ? explain me with understanding example?

Can you help me with source code to get the date 1 jan 2009 in the format 01 01 09. Actually I've to form a verification id for issuing gatepass which uses last two digit of the year,then net two digit consist of month and next three digit consist of …

i have put my application on a pc with just .net framework 2.0 on. I get a crystal report engine error as noted below: See the end of this message for details on invoking just-in-time (JIT) debugging instead of this dialog box. ************** Exception Text ************** System.IO.FileNotFoundException: Could not load …

Help me I have created a dataset. Then created two data tables with dataset.tables[0] as data for first table and dataset.tables[1] as data for second table. then I created parent and child coloumns. then I created parent row. Now how can I need to select childrows from parentrows. Regards jineesh

i want run an applet as an application and i want to run an application as an applet. i know there is a way to do it with only two lines of code i just can't figure it out. do any of you know how to do this? any help …

Hi..I am Fredy I want to access and get record from database mysql online( on internet) using vb.net could u help me how to connection and get record from database online. thanx Fredy ym:zuve_fox@yahoo.com.au

[code=vbnet]Imports MySql.Data.MySqlClient Imports System.Data Imports System.Configuration Public Class frmMasterCode Dim conn As New MySqlConnection Dim myDataAdapter As New MySqlDataAdapter Dim sqlquery As String Dim cmd As New MySqlCommand() Dim myDataReader As MySqlDataReader Private aeps1DataSet As epsDataSet Private amasterCodeTableAdapter As epsDataSetTableAdapters.master_codeTableAdapter Private WithEvents amaster_codeBindingSource As BindingSource Private Sub frmMasterCode_Load(ByVal sender As …

Ezzaral & James -- I remember (and found) a thread from a while back where you guys gave me an example of an Observer pattern. Basically a model had a List of interested Listeners. When the model changed, it went through a for loop, notifying each listener (the views) that …

so my program has to read data from text file and pass it to the function. text file contains integer and string in every line. it looks like this: 23456 john 96512 martin 56985 wendy i've written it in C using this code: while (fscanf(filestream, "%d%s", &key, &value) == 2){ …

Ok, so this is kind of a complicated question... but... Ok so I have a python script, you enter some numbers it gives you some numbers back that sort of thing. But of course right now it just looks like a black window with text. kind of like [URL="http://blog.benhall.me.uk/images/InstallingWindows2008EnterpriseCoreServe_F3A1/6Cmd.jpg"]this.[/URL] But …

Hello, I am trying to create a program to stress test a website, I am using a counter on the page to see how many "clicks" have been made to this website. Currently i am using HttpWebRequest to make a connection to the site and then end it. However this …

Hello, I am getting the follwoing error in my program: *** glibc detected *** free(): invalid pointer The program is as follows. [ICODE]int main() { operation1* sjob1 = new operation1(); answer* ans1 = sjob1->execute(); delete sjob1; operation2* sjob2 = new operation2(); answer* ans2 = sjob2->execute(); return 0; }[/ICODE] I have …

Hey ppl, i am trying to do this exercise from my java book, but i cant do anything right apparently :( [I]Write an application that asks the user to enter an integer n, and then draw an n by n grid on the panel. whenever the user clicks inside one …

This is part of a connect 4 game. I'm trying to get a picture to move each time a player makes a move by calling paintComponent but java won't let me. How do I move a picture in my code? [code] import javax.swing.*; import java.awt.*; import java.awt.event.*; public class PanelC4 …

what is mean by delaysigning in assembly..when we use it in c# .net

Hello everyone, I hope I have posted this in the correct forum. I have a good knowledge of VB.Net and VC++ and have now takent he brave step into assembly level programming. I'm starting out with just a bit of inline assembly in a c++ program and toying around with …

In one View, I have text boxes and buttons. In the other View, I have a Pie Graph that I created using JFreeChart. When the button is clicked, I want the Pie Graph to be refreshed, displaying the new percentages (based on what the user entered in the text boxes). …

Hi everyone! I'm writing trojan/virus for educational purposes only. That is my final practical work. The problem is that i need to fire up a .vbs file from disk.To do that i need path. How to find path and save it to string variable. Even bigger problem is how to …

Hi I am making a rock, paper scissors game for fun & for practice. My problem is; I am trying to create a string by adding 2 character variables together. How do I do this? Do I use the insert function? Or something I think is called crstrt or something …

Hi, to answer this question you need to have some experience about php... i'm planning to create a http server that supports cgi. Does anyone see the problem in C++ -source? Php doesn't give any output, but if I don't set the rfc3875 environment variables, all output comes normally (expect …

Hi I made a code where user can guess the number. Now I would like to implement the number of tries and I would like that the user will only guess til 3 times. It seems I'm quite lost here. I tried to declare it as constructors but not sure …

Hi, I am looking to create a C# application that when ran remains inactive (and hidden) untill I hang the mouse over something.. such as the 'My Computer' icon on my desktop (it will then display a message). Is this possible? If so, can anyone point me in the right …

I need to take a text file of a number of gene sequences in fasta format eg >geneA agctactactacgatcgaacgtagctactactacgatcgaacgtagctactactacgatc gaacgtagctactactacgatcgaacgtagctactactacgatcgaacgtagctactact acgatcgaacgtagctactactacgatcgaacgtagctactactacgatcgaacgtagct actactacgatcgaacgtagctactactacgatcgaacgtagctactactacgatcgaac gtagctactactacgatcgaacgtactacgatcgaacgta and put it into: geneA agctactactacgatcgaacgtagctactactacgatcgaacgtagctac where all of the sequence is on one line. I can concatenate it in excel for one sequence but i have …

I have been working on an assignment for a while now and I have had many problems making the program work from the information and help supplied by my course. The program I need to make is one that analyses text files to obtain statistics on their content. The following …

I am writing a simple program for managing the final grades of students. The program first read original data from a file called "final.txt", and create a linked list to store the imfornation in memory. The format of the orginal data is "Class_Character Seat_number Computer_grades Laboratory_grades". There is only data …

i couldnt manage to change system.windows.forms.listbox item color, do you know how to do that? thanks.

Hi , Can ne1 tell me how 2 write a c++ program to find out the determinant of a (mxn ) matrix (need not to be square ).. If possible give me the code ,of some link whr I can find it ...