Software Development Forum

hello again everyone to pick up where i left off, i took the advice of a member and split my poker game up into different classes which i will post below 1)i need help with two errors in the poker class which i have commented out as compiler error messages …

Hi, I have a small problem, I am trying to insert a new row into a batabase table using linq to sql. I have Microsoft publication on Linq but it was based on the beta of Linq and does not match the current version completly. I have a class P11Entry …

int main( int argc, char *argv[] ) { ==> This function has over 60 lines. You need to split it into smaller functions Everytime I try to split it up I just cause errors (it compiles but locks up when I run it through the test system so I think …

Hey, it looks like I'm stuck yet again. I've been working on this for awhile and I can't figure out why it's not working properly. Here's what I'm supposed to do: Create a function that simulates coin tossing. The function should have no input and no return value. When the …

Hi I am using jmf to build some music player and im want to add some equalizer that will "jump" up and down according to the music, how can I do it?

hello friends , i am searching job and put 5 projects and i am finding difficulty in explaning the current project so please can anybody tells me how to explain the project ,i mean how to start explaining and what should i explain .please its really urgent i am finding …

I have a problem that I've been puzzling with so I thought it was time to ask the experts. I have two csv files that I am trying to search between. One csv has a Title column, and a URL column. The second has a variety of columns but a …

Hey I'm working on this program that tests you on a few questions. I enter the answer to one and it comes back and displays correct. For some reason though when the next question comes on it already comes back with a response saying the answer was incorrect. Here's the …

hello, actually i need some help please, lets say i have a folder on my computer that contain only jpeg pictures and i wanna load them on a win form, and then have a next and previous button on the win form that will move among the images in the …

hey I have been looking up shapes in c++ but everyone talks about needing certain compilers and #includes but i don't have those compilers i have just been using the standard Microsoft visual studio at my school i think and my teacher has just asked us to create different shapes. …

I am new to programming and have a question regarding a homework assignment. First off this is for an Inventory Program and it is part 2. The assignment is as follows: Modify the Inventory Program so the application can handle multiple items. Use an array to store the items. The …

I'm developing a Java application where I have to implement Shortest path algorithm (dijkstra's). I've stored the details of nodes in database. But my problem is that the number of nodes is very large (1000+) and taking all the nodes into consideration will increase the time and space consumption of …

Good day to everyone...I'm a newbie here and a novice in VB6 programming... I really having a hard time formulating the correct syntax on how to merge multiple tables in Access 2003 using VB6. All the tables that I want to merge had the same fields. For example Table1 includes …

I have two Issue using a MDI app. 1-at this moment I'm able to open MDI child forms using the MDIparent except when the I opens form1 I'm also able to open forms 2 and 3 . but I only want one form to be open at a time. 2- …

I have to write a function to rotate an image 90 degrees clockwise. I got it to rotate. But it also flipped and rotated counterclockwise. So wrong way, and it flipped along the y-axis. Really weird. [code=python] def rotate(self): rotatedImage = EmptyImage(self.height, self.width) for row in range(self.height): for col in …

I'm continuing my project and found a strange error, I can think of ten thousand hacks to get around it and a few ways to fix it properly, but my curiousity is peeked. why Is AStringBufEx end result 18 characters long when the Lenth of the initial string is only …

I made a project (exe). I want when a user use it , after 6 month or 1 year it will expired. I mean the exe is use for 1 year. after 1 year it will show a msg. like: demo version for 1 year. contact with author.

i am doing a project with visual c++ .In my project I have 2 forms . I want to do some calculation of some data of the form Form1, and i want the result of this calculation to write to a label of Form2. How to do this?

Can anyone lease tell me the value of k? I know it starts at 0 and loops backwards but I can't figure out where it terminates. I would really appreciate someone telling me the best way to figure this out so I can solve these problems in the future [code] …

OK so I have this WebBrowser1 and Button1 controls. After you click Button1, program will access website, takes some HTML data, removes unwanted HTML tags and then WebBrowser1.Navigate("about:blank") + writes my HTML to the blank page. Everything works great until.... Until you click the button 2nd time. Then you'll get …

Hello, I need some help if anyone has an idea. I'm working a memory management simulator trying to implement a mark & compact algorithm. To do that I need a function that can move/copy a block of memory from address A to address B. I tried using [CODE]memmove (dst, src, …

I have a large file to read to get the data out of the columns. File size varies, but is usually around 1000 to 3000 lines. What I need to do is pull the data(numbers) from column 3 ONLY if the number in column 4 of that same line is …

I do not understand what I am doing wrong... I need the second triangle to print the character the user inputs, but instead - and I have no clue as to why it is doing this - it prints the second triangle with smiley faces and other symbols. Any help …

[CODE] private void cmdSales_Click(object sender, EventArgs e) { backgroundWorker1.RunWorkerAsync(); timer2.Start(); } private void timer2_Tick(object sender, EventArgs e) { TimeSpan ts = DateTime.Now.Subtract(startDate); string sTime =" ..." + ts.Minutes.ToString("00") + ":" + ts.Seconds.ToString("00") + ":" + ts.Milliseconds.ToString("000"); toolStripStatusLabelTime.Text = sTime; if (toolStripProgressBar1.Value == toolStripProgressBar1.Maximum) { toolStripProgressBar1.Value = 0; } toolStripProgressBar1.PerformStep(); } …

Dear Guys, I am Simone from Rome. I have a problem. I need to write an algorithm for the encryption of data, and to implement it I need to work with integer numbers of about 100 ciphers (for example I need to make a multiplication between 2 numbers of 70 …

Today I had this question in my exam: [CODE]write a program in C++ that covers the next points: -a company needs to enter its employees' data into the computer -each emplyee has (ID-Job Code-Division Code-Salary) -should be done using struct -Input/Output functions should be inside the struct -use the struct …

Could someone explain how to get to the answers. I read the book from class and cannot find the answers to the last 3 problems. I am not asking for the answers, just how to figure to resolve the problem. I appreciate the help. Consider the following selection statement where …

Hi, Can someone please help me. I am getting error: The process cannot access the file 'c:\reports\PaymentDetailReport.xml' because it is being used by another process. in following function. This method is suppose to be called couple of times. but at second time, it throws the error. I have even closed …

Hi, I have a problem with the tolower function. I use Netbeans 6.5 with GCC C++ on Ubuntu 64bit. The problem is, that I use nordic letters like å, ä and ö and the tolower function does not affect them at all. I have tried almost everything. I have tried …

Hi I'm trying to create a dialog box with GenBitmapTextButton buttons. When I create the dialog using the standard button, I can use the enter key to push the button, and the escape key to cancel the dialog. However, when I use the GenBitmapTextButton, neither the enter nor the escape …

Hi guys, new to the forum so i hope that my first topic wont be full of errors. Anyway, i just started programing a couple of weeks ago in a program at my elementary school, and i have a couple of Q's. so this is my prog. [CODE] if(ima == …

Hi all, I have a very easy question (I think, at least), but I can't for the life of me figure it out, which makes me feel stupid. I'm trying to make a function to generate buttons (I have quite a few buttons in my app and don't want to …

Hey everyone, I have the following data set A B C D E F G H I J K L M N O P Q R S T Where every ten lines or so (though not a regular pattern) the data breaks its format and two of the data pieces …

Hi all, I am using Visual Studio 2005, and developing some application. Currently i am facing one problem. I have written a class and declared some member variables in the class. In the constructor i am initializing the member variables to 0(member variable is int). But when i debugged the …

Hi , I am trying to bind a drop down and checkbox with values from two tables from database. The 1st table has categories and is binded to the DDL and the 2nd table has sub categories and is binded to checkbox and inter related by using the category ID …

[i](Im using VS C++ EE 2008)[/i] Hi people, i have had a strange problem today. Im currently programming something to do with Physics. I have searched the Internet already for the answer, including this site. The problem is: [i]error C2064: term does not evaluate to a function taking 1 arguments[/i] …

hi guys.. i'm doing this program.. haven't finished it yet.. i'm not getting any errors but the program is not running correctly.. I dunnu y,, i did everything i had to and it says 1 succeeded with no warnings ! here is my code.. [CODE]#include <iostream> #include <fstream> #include <cstdlib> …

Note, some of the code could be hard to understand as a bit is in Swedish. Hi! I am trying to learn some sql/java. I created some tables in an sql-database, and a java-program to access and modify the tables. I am not that experienced in programming so I might …

I have a text file with something like this in it: >ENSG00321 Gene_ch19 . . . . AATAGCGGTTAACATATTAATTAAACTAATGTATAGATATTATCCGCTTCCAGATTTATTATTTTGTAAA ATAGGCACAGTTCTTATCTGGTGTCACTTTATGCTTTTTTAATAGACGCCCAGCTCTACTCATGGCCAAG . . >ENSG00531 Gene_ch5 . . . . AAAGAAGCGTAGGCCCGCCATGCAGCGTAAAAAGGATAATGCGGAGCAGCGGTCCCCAAAGACTGATTTA TCAAAACTGTTTTCGCAGCAATTAACACACCCACCGACCAGTAACACCGCTGCAAGCAAGGCCACGGGCA . . I have some headers like (ENSG00321) too. I want to search in text files with header and then get …

Hi, I want to create a sequence of vector<double> each with a name + a number that goes from say 0 to 9. For example, how do I make a loop that creates10 vector<double> that goes by the name : vector_0, vector_1, ..., vector_9 ? Thanks.

First let me say thanks to everyone who has been responding to my posts and providing valuable insight. I have been trying to add rep whenever possible, and appreciate your help. My assignment was to write a python code which takes data from an infile, then has the user specify …

This is the hex output from a LARGE_INTEGER. "EA 00 0B 00 A1 00 00 00" On my machine a DWORD is read "00 0B 00 EA" How do you place the high 32 bits in the sequence? This leads me to the question of how to output this to …

Dear All can we filter subset of DataSet.Table row collection in ADO.Net. Early days adodb's recordset was providing Filter method to get subset of its records, but i couldn't find a similar option in ado.net. thanks in advance and looking for your immediate suggestions Warun

Hello, I'm currently developing a application in VB.Net. I'm using the DataGridView to display my data on the form. I have a EDIT button on the module and I need to know how can I populate a selected record into the textboxes from the DataGridView. Hope you could understand my …

my code so far...... [code=cplusplus] // ProjectDevelopment.cpp : Defines the entry point for the console application. // #include "stdafx.h" #include <iostream> // This libary allows standard input and output operations. #include <string> // strings are used as tempory storage - for the input to a text based file #include <vector> …

Hi, How do I add a subitem to a listview in WPF? I'm coding in VB and I do not see any subitem in it. Thanks

I am constructing the control flow of the program. I am reading the bb.ls file and in that file I will search for ‘b’(branch instruction), if ‘b’ is found I create a newnode and store the node count and store the address of the next node( linked list). My doubt …

When i handling my project exception occurs thread aborted.

hi guys, hopefully somebody can tell me what i'm doing wrong here: i'm trying to put together a copy constructor with this linked list class, but i just cannot get it to compile: [code] #ifndef LINKEDLIST_H #define LINKEDLIST_H //*************Include Statements************* using namespace std; // for cout //***********END Include Statements*********** class …

Hi All! First thanks for viewing my thread. I have spent a half day and change trying to find a solution to this specific problem. Basically I am trying to figure out how to change the variable name while in a loop. The last loop is where my problem is …