Software Development Forum

i am in a first semester programming class and this probably might seem like a dumb questino to everyone here but i have been working on this for along time and cant seem to come up with anything. i am stuck on 2 programs. the first is to ask for …

Hi, i have bieng trying to write a method which takes a listbox index (1D array) and find the corresponding 2D index. I did this code with some help which get the 1D index of a 2D array. Now i need to do the reverse from listbox index (1D) and …

Hi everyone, I have four forms. Form1 is the main form and needs to be kept open and visible at all times but cannot be clicked while the other forms are open. For example, the main form is open and after a certain amount of time the second form opens …

I thought it was a simple task at first. Don't ask me why, but I wanted to display a number in it's binary form. Manipulating bits in C# seems a bit(no pun...) harsh. The best I could come up with was : [CODE=csharp]static void Displaybinary( uint i) { const byte …

Hi, I had posted this question before and I did appreciate the response I got. However I still need some little help as: [B]1.In the addMovieGoers method check that every member of the collection is a human and that they are old enough to watch the movie, if not throw …

Hello, I am reading this turorial [url]http://diveintopython.org/soap_web_services/introspection.html[/url] and i am trying to echo out all my wsdl method. I am trying to do this on my external web hosting server. I have got the modules installed but i am getting an internal server error [url]http://adamplowman.com/cgi-bin/test_xml.py[/url] here is the code [CODE] …

Hi, I working on COM Components in VC++.NET 2005, [CODE]HRESULT hr = spCrypt.CoCreateInstance(__uuidof(Cryptographer::TMMPlayerHelper), 0); if( FAILED(hr) ) spCrypt = 0;[/CODE] I am facing an error here. I debug the code and found that "CoCreateInstance()" is returning a message "Class is not registered" an my program gets crash. How can I …

Hi. The program works fine if i just compile and run. But for the program to get graded it has to pass a test written in python which it does not. Since i'm complete dummy at c and programming if you find to explain, dumb it down please... so here …

First off, I know that to set an indexed variable, say, mylist[3] = "Hello". I also know that you wouldn't be able to set mylist[3] if you didn't first state: [code = python]mylist = ["Whatever", "Whatever", "Whatever", "Whatever"][/code] But, if you had a variable with an extremely large index, it …

I am having a problem with a class I am writing. I have defined a whole bunch of methods defined that the compiler is telling me in the implementation are different. The errors are: [QUOTE] 1>------ Build started: Project: prog6a, Configuration: Debug Win32 ------ 1>Compiling... 1>main.cpp 1>c:\users\philip\documents\visual studio 2005\projects\cs211\prog6a\prog6a\avltree.h(186) : …

Hi, let's say I define this two classes that do not inherit from one another. I get an error at line 10: field "DataNoFather" has incomplete type. 1.Any idea what that means and how to fix it? 2. Is it possible to have a variable like DataNoSon labeled with type …

What is a clock tick equal to in ctime??

I remade an equation-solver program from Java to C++, and I plan to post it soon but I would rather not until I can determine where modulus fits in with PEMDAS. To those who don't know, PEMDAS is the order in which mathematical expressions are to be evaluated. The order …

Hi there. I started with wxPython (Under Linux) a little while ago and I'm enjoying very much, however, there doesn't seem to be a control for working with Rich text. Iv found a few articles (mostly dated a few years ago) that suggest that such a control is on its …

Hello., Im learning C online, and one of the examples from the internet is this: [CODE] #include <stdio.h> int CalcVolume (int length, int width, int height); void PrintIt (int vol); void main() { int volume1, volume2; int x = 8, y = 15, z = 20; volume1 = CalcVolume (10, …

I have got two arrays. One for initializing and another for displaying. The display array always shows nothing if the initializing array has not been called. The problem now though is that if I want to insert something in a certain slot in the array nothing happens and I dont …

Hi, this is my first post here so I am not quite sure how to enter codes properly, but I will do my best to explain my problem anyway... Suppose I have a new form (Form1), and I insert a combo box (ComboBox1), and the items for ComboBox1 are 1, …

I am a bigginer in python and even programming. I want to use python in my thesis for reading and writing large size data. I have a little sample of code which access which runs over the lines and reads each element on a line. [ICODE]def get_site_only(pat): newpat = "" …

ok lets say I have my code file in my web server and any one can call that functions in that file ( assuming they know the name of the functions ) but they can't see the actual implementation in other word they can use the implementation but they can't …

I did make my dll file out off those two files dll.h [code] #ifndef _DLL_H_ #define _DLL_H_ #if BUILDING_DLL # define DLLIMPORT __declspec (dllexport) #else /* Not BUILDING_DLL */ # define DLLIMPORT __declspec (dllimport) #endif /* Not BUILDING_DLL */ DLLIMPORT void welcome(); class DLLIMPORT DllClass { public: DllClass(); virtual ~DllClass(void); …

I attach a file what was send by Shaik Akthar. I work with it a new access file. He use Table, I use querie. But it not work.I modify some code like: MSFlexGrid.FormatString = "<DATENOW|<NAME|<DIAGNOSIS|<REMARKS" MSFlexGrid.FormatString = "<Student ID|<Student Name|<Jamal|<Roll No" Con.Open "Provider=Microsoft.Jet.OLEDB.4.0;Persist Security Info=False;Data Source=" & App.Path & "\DB2.MDB" …

I have 2 examples for inheritance in Java The first works but the second not. I wonder why. Does the extended class must implement constructor with [B]super()[/B] [code] class Counter { int i = 0; public Counter() { i=1; } Counter increment() { i++; return this; } void print() { …

Hey guys =] First I just wanted to say I am excited to have found this forum, it looks like the members are very helpful and friendly! Hopefully I'll be able to contribute what I can but I'm not very knowledgeable :P Anyway, I am to create a grading program(utilizing …

hi guyz.. by the way im using crystal report 8.5 in my project. i have already a report but the report i have is to diplay the viewer.. i want it to automatically print it, without preview the viewer.. what code shall i used? shall i use crytal report? or …

This is supposed to draw a line through the JButtons when square9 is clicked. It doesn't work but there are no errors and I don't see what the problem is. Ezzaral gave me the code to draw the line earlier. Obviously, the winning squares aren't always diagonal, so I will …

I have this idea that I want to write an operating system. I've started to learn C++, but I have a few questions...One is, obviously, am I using the right programming language? I have looked at a few forums on this site, and it seems to be half of the …

Hi Guys, Have a question regarding the exception filter. I have a MiniDump class which looks like this: class MiniDumpHelper { public: MiniDumpHelper() { ... } LONG WINAPI exitWithDump(struct _EXCEPTION_POINTERS* exceptionInfo) { ... return EXCEPTION_CONTINUE_SEARCH; } } then i have a host.cpp class where i have a `main()` I try …

I'm currently writing a program that requires me to check several char values using a while statement and I keep getting the error "operator || cannot be applied to char, char". My code works fine with a single value but as soon as I add || or && I get …

I just started learning SDL so I can make games in C++, but for some reason my code fails to compile. The code: [CODE=c++] #include "SDL/SDL.h" #include <string> using std::string; int SCREEN_WIDTH = 640; const int SCREEN_HEIGHT = 480; const int SCREEN_BPP = 32; SDL_Surface *message = NULL; SDL_Surface *background …

This is more of a general question to see if I got the concept. I defined a class with private member data: one is an int variable and the other is a pointer. 1. Where is the int variable stored?... on the heap or on the stack? 2. Where is …

When I enter a decimal into a field by the time it gets written to a recordset it has been changed to zero if the value is less than one and it is rounded up if the value is greater than one. Any suggestions?

Hey guys, I'm working on my homework assignment and I did all the code, but I can't figure out how to display the "hours of labor required" and The number of gallons of paint required. Here is the assignment: A painting company has determined that for every 115 square feet …

Hi, I'm new to Perl but I'd like to know more. For this purpose I downloaded the ActivePerl-5.10.0.104-MsWin32 .msi package and installed it on my computer OS XP Home. Xitami, PHP, MySQL were already installed, and PHP can connect to MySQL. Now I run the following code from the command …

I have a TicTacToe board and I need to draw a line through the X's or O's when someone wins. I know how to use the paint method, repaint, etc (as far as how they're called & the basics). I'm just not sure how to go about actually drawing the …

I program using Win32 API's. I compile with Borland or Microsoft "CL". I am on an XP machine. I use .cpp extensions to compile so C++ rules apply. I'm trying to get the bytes from my screen and send them to a disk file. I get a handle I call …

I have this program and I have made the changes. Now I am trying to implement the stack within my code and im confused. I need to push the environment_types onto the stack but I dont know how. Here is what I have [code=syntax]int X=0, Y=0, Z=0 ; /* Evironment …

I have 1 line in this code that I can't get to compile. I'm new to C++ and begging for some help...any advise would be appreciated. [code] #include <iostream> #include <iomanip> using namespace std; double population(double pop, double birthRate, double deathRate); void printPopulations( double startPop, double birthRate, double deathRate, int …

Hello again guys! i have a simple question how to promt user to enter a number for example 444 or whatever and for c to print it as a 9 digit number, so if its 444 c would print it as 000000444? any help would be greatly appriciated., thanx!

I'm a newbie at posting code so I'm sorry if I make any mistakes. The 26 line won't let me compile and I don't understand why. can anyone help me??? [code=cplusplus] #include <iostream> #include <iomanip> using namespace std; double population(double pop, double birthRate, double deathRate); void printPopulations( double startPop, double …

I'm having trouble implementing isalpha in the correct spot. When I put it in the if statement, it doesn't determine the palindrome correctly. It says everything I entered is a palindrome. Then I try to implement it with the int k, but then it gave me "parse error before +," …

I can't get it to compile. Here are the instructions for the assignment: Write a program that determines which of a company’s four divisions (Northeast, Southeast, Northwest, and Southwest) had the greatest sales for a quarter. It should include the following two functions, which are called by main. • double …

I can add a new node if the head is empty, but I can't attach a new node. Instead I get a null pointer error. Can anyone see what I'm doing wrong. I think I've been staring at this for too long. EDIT: Forgot to say I'm adding the Nodes …

Okay i need this quick please i am kind of stuck basically i have got to find the highest and lowest numbers out of four integers. Is there a function in java.math or do i need to make one using a loop maybe?

I have the following GUI code but my JLabel for results doesn't work when either of the buttons are pushed [code] import java.awt.*; import java.awt.event.*; import javax.swing.*; public class TempConverterPanel extends JPanel { private JLabel input, results; private JButton output_f, output_c; private JTextField temp, fahrenheit, celsius; public TempConverterPanel() { setLayout …

Hai there, I would like to ask about currency format in Bash script let say i have $US2550000, after format it, it become $US2.550.000,00 Thanks for the help

Hi all, Can anybody help me out with the connectionstring for connecting VB6 to a Microsoft SQL Server 2005 Express Edition. I have tried several documented varieties which do not work. My latest attempt was a version from [URL="http://msdn.microsoft.com/en-us/library/bb264566(SQL.90).aspx"]this website[/URL]. I downloaded the application and associated files and changed the …

I'm fairly new to making GUI's in tk so I downloaded activestates GUI builder from sourceforge. It has a very straightforward drag and drop interface and is easy to pick up. However I ran into a problem trying to edit the widgets it creates. It makes 2 files, the first …

I ve to Write a Python program that prints a random DNA sequence in Fasta format. That program should ask for the length of the sequence and suggest a reasonable sequence name. The session should look something like: > python randomdna.py Length: 34 >MySequence TGCGCATATTGTCTAACTATGGCTGTGGCCGGA The output must be in …

Hi, I want to use outputs from different forms of a project and save them into a single text file that could be from a module. Please suggest any tips on this. Abhishek

hi all, if you look at the code below you will see that i am trying to get a template function to return an iterator based on the type type of one of its parameters, i cant seem to get it to work i dont want to have to pass …