2,977 Topics
 | |
| | I have a question about embedding Perl scripts in C. I wrote most of the program in C and a portion of it in Perl. As of right now, to call the Perl script I'm using pipe(), fork() and dup2() to create another process and have the Perl application write … |
| | Hello, I am new to Perl - and so far I am enjoying it. Unfortunately I do not have the luxury to start completely from scratch. I have here a problem that i am struggling to solve. I have spent [B]many[/B] hours trying to solve this issue without any success, …  |
| | Hi everyone! So here's my problem: Given an element, I need to get the index of the array in an array of arrays. For example, I have the following array of arrays: [CODE] my @arrOfArr = ( [ "1023", "1472", "0751651"], [ "1527", "1167", "2496111" ], [ "M167", "1412", "1761683" … |
| | Greetings All, I'm working on some code to essentially build a CGI page where the user places in there SPNs in the form with spaces(example--->) (967866 4566776). Then it calls the subroutine to run a join command to take the SPNS given by the user, and parse them with commas(example--->(967866, … |
| | Hi everybody!! I think this is a simplest perl related problem..but still I need your help. Here's my sample input file: [CODE]>blast ATGGGCCTAC ATCCACSTAT[/CODE] Please note that the number of lines could be more than these two, but the Perl script should skip the first line which starts with '>'. … |
| | Hello, I'm new with perl, I've been able to read and write from file #1 to file #2. file #1 currently is about 60meg of text... what I would like to do is to read up to 2 char from a constant position and then use that data in a … |
 | I was wondering if there is a global matching flag, considering there is a global replacement flag (/g) I'm using this workaround to make multiple matches in a string [CODE] while(!$stop_var) { if($source =~ /(PATTERN)/i) { push(@matches, $1); $source = $'; } else { $stop_var =1; } } [/CODE] is …  |
 | Hi all, I'm relatively new to JS and I have an issue which I can't seem to get my head around... I have a perl script which iterates through an array and populates a table with its values. Within the created table I have a link in each row which … |
| | Hi All, I'm a trainer and I recently wrote a training booklet to be handed out at the end of Perl training courses. It has a creative commons license so I thought I'd share it here with you all. It's not designed to be a booklet for learning Perl, more … |
| | Well I'll go straight to the point... I'm trying to recursively move through a binary search tree. I'm not really sure what is wrong with my algorithm (and I'm also pretty new to recursion) but this is what I have: [CODE] public boolean contains(BTreeNode<T> node) { return containsItem(root, node); } … |
| | dear all i am new to perl. when i run my basic perl program as follows[CODE]print<<EOF; HELLO MY NAME IS MANISH ARORA EOF[/CODE] i am getting this error Can't find string terminator "EOF" anywhere before EOF at PERL.plx line 1. please help |
 | Replacing a field separator during a read. I want to replace a pipe symbol (|) field seperator with a tab when I print the contents of records in a file. This is my text file:[quote]Jeremiah Stein|LW89W|1|U Patty Smith|JJ12R|2|W[/quote] The cgi script I wrote will read it and print it out … |
| | Which is the best way to make a plataform-independent perl app, I tried Perl Packer but it seems it wont work on windows, I don't want to use activestate? what are my alternatives? |
| | Hi all, This is my first post, and I am certainly no perl programmer. I do have programming experience and have inherited a some perl code written by someone else. I have spent days trying to find the solution to this, so here it goes. This script parses a tab … |
| | I inherited an ancient C program that was a Windows console application. The application connects to a data source and returns some values to the console. A very simple application. I had to make some changes and recompiled the code under Visual Studio 2008 C++. It compiled, linked and ran … |
| | HELP Please - I have hit a wall in trying to get the following perl created web page to work correctly. It is designed to find all the pictures (.jpg) in all folders below the designated one and to then display them in individual slideshows. I have a version of … |
| | Hi everybody..Here's an interesting problem to solve. I have a text file like this (also attached): [CODE]>first TTCCCAAAAAAGACCTACTAAGTCAAGCGGATGCGTTTTGTGTCTTATGG AAAGTCCCTGACGGATACGAGGCTTTGGGTGATTCGGTACGAATGATTCG GTTACCAGAACTTACCGAAGAAGAAATGGGACGAACCGAGGTTTCTCGTT CGTGTGCTAATCCTACATTCAAACATCGATTTCGATCAGAGTTTGTTTTT CATGAAGAACAGACATTCGTATTACGTGTTTACGATGAAGATTTGAGGTA >firsta TTCCCAAAAAAGACCTACTAAGTCAAGCGGATGCGTTTTGTGTCTTATGG AAAGTCCCTGACGGATACGAGGCTTTGG---------------------- -----------------AAGAAGAAATGGGACGAACCGAGGTTTCTCGTT CGTGTGCTAATCCTACATTCAAACATCGATTTCGATCAGAGTTT------ CATGAAGAACAGACATTCGTATTACGTGTTTACGATGAAGATTTGAGGTA[/CODE] Both >first and >firsta containing same characters except the part with hyphens. Now is it possible to write a perl script that … |
| | I've been having problems with web browsing that I think may be related to Javascript. I use forum sites like [url]www.ernya.com[/url] and there I get logged out every few minutes/seconds. I've found that clearing my cache regularly seems to help a little, but it doesn't fix the problem. Other forum/avatar … |
| | hi guyz..how r u? I am facing a problem with a simple Perl script. I want my code to calculate the length/number of letters present in a text file (which is the input). But it should skip the line starting with '>'. The input used is given below (also attached). … |
| | I can't resolve a question.write a stucture in html that can call a perl script.please help. |
| | i'm using VB \ ASP.NET. i'm trying to display some values in Gridview. but i don't know how many columns i need to display. at run time only i will come to know how many columns i need to display. it depends up on the values from Database. so i'm … |
| | Is there a way to write a perl subroutine that can read in a file that contains 2 strings on each line and then can create a has with the first string as key and second string as value without using the use the Tie::File::AsHash module ?  |
| | Good day, I was looking for a good subroutine to parse BLAST records without using BioPerl. I have to open a BlAST results file and then use regular expressions to parse out the query, BESTHIT (highest E-Value), E-value, and the identities. I have to parse them out and then print … |
| | When parsing an EMBL record (attached) do I follow the same directions as when I parse a GENBANK record? I have to print out the ID, KW, OC, and SQ fields once I parse the record. I have a code that would parse a GenBank record and would like to … |
| | what are differences of subroutine of perl with PASCAL? |
| | Good day, I am new to the site and would like some help on a code. I must write a perl program that gets the average of each column of numbers in any file? The format is: 1 2 3 4 5 6 6 6 4 4 2 3 4 … |
| | I have no good regex experience -- its all pretty new and confusing to me. I understand some of the VERY basics, but to do what im looking for...is way past me! I have the following text i would like to parse, pulling out the highlighted section everytime. Unknown Trap … |
| | I must find the restriction maps in a FASTA file and then for every sequence print out a graphical display of the cut sites in the restriction map by printing the sequence and labeling the recognition sites with the enzyme name. I also must use a hash to store the … |
| | i m developing website in asp.net n page name is 1.aspx i want to show records in table form but my requirement is that it should be hyperlink username when ever visitor clicks on that.next page will come n the username passed to another page <td><%#Container.DataItem("[COLOR="DarkRed"]user_name[/COLOR]")%> </td> |
| | I have a pair of questions.. I am quite new to this gridview in asp.net using C#.. I have used the following code to bind the sql database table from my gridview. [CODE]SqlDataAdapter da = new SqlDataAdapter("select customerid, customername from table",con); ds.Clear(); da.Fill(ds); gridview.datasource=ds; gridview.databind();[/CODE] And set the autogenerate columns … |
 | OK, here's my last problem for this project I am working on. This may seem very simple to most of you, but I cannot figure it out. I have a simple confirmation page that reads something like: You have successfully created your event, the link for people to signup for … |
| | Hello, I am parsing a rebase file and using different subroutines from the BeginPerlBioinfo module. I have used the subroutines I think I need but I keep on getting the message"use of initialized value $site in concatenation or string <$fh>. [CODE]use strict; use warnings; use P4; # Declare and initialize … |
| | Im sure this is real easy... Please forgive my limited .Net abilities... The script below genereates the correct value I need... I just want ot place the value obtained by dblTotal into a flash param... the param below is what I imagine it would look like. [code=c] <script Language="c#" runat="server"> … |
| | Hello, I would like to know if I need to use a regular expression to match the desired substring in order to print out 10 characters of the start codon ATG. My dna sequence is "CATAGAGATA" Thanks for any advice. |
| | How can I print some numbers during a loop for example I have a while loop, and while the loop is running i want to print the numbers of times the loop has been repeated. |
| | Hello, I have about 500,000+ txt file for about 7+ gigs of data total. I am using python to put them into a sqlite database. I am creating 2 tables, 1. is the pK and the hyperlink to the file. For the other table I am using an entity extractor … |
| | Someone mentioned in another thread they had found and downloaded [URL="http://search.cpan.org/~adamk/ORLite-1.45/lib/ORLite.pm"]OrLite[/URL], presumably to consider using it to access data in an SQLite database. Since, to use OrLite you need to have the DBI and DBD::SQLite modules installed on your computer as well, I think you could just use DBI to … |
| | I need some help setting up a perl script which will provide the statistics on some data I have in an excel file. My plan was to copy the excel file into a text file (with tab delineated columns) and run the script off of that. I downloaded a simple … |
| | I had a website that was made for me a while back. I am trying to update the info. I am doing my best to make changes to the code. It renders fine in all the major browsers except IE. This page in particular does not work, [url]http://brighteyedcomputer.com/test/site/contact[/url] . The … |
| | Hello, I have written a script to automate a software install. I am running the script as root, but need to su to another user to configure and complile the program properly. Whenever I do the shell script su's to the user properly but the scripts stops executing until I … |
| | I know next to nothing about statistics so tried Statistics::Basic because it seemed easy to use. Then I tried Statistics::Descriptive because it has functions that Statistics::Basic lacks. What I did not expect was to get a different result when calculating Standard Deviation using Statistics::Descriptive than when using the other module … |
| | What is the difference it seems push and pop work just like unshift and shift respectively . |
| | I am starting to learn Perl and I have coded few tools (converters, calculators, etc.) to get some practice, I easily included these tools into my website just changing the extension .pl to .cgi and adding this line: [CODE]print "content-type: text/html \n\n";[/CODE] so..when should I start using catalyst and why? … |
| | Hi , i'm trying to add a hyperlink in the php code , the "href" of the hyperlink is the books names generated from the db but i want to the clicked link to show the relative book description and the book's image in another page but i don't know …  |
| | dear friends developing data driven website with asp.net n access database 1)plz provide the detail code with inheritence n also import classes i want to execute insert query in asp.net +vb syntax on submit button 2) if data is store i want to show in table with pages count eg … |
| | Perl/apache if we run the Perl script on apache for display the result of Linux command it is not able to execute the Linux command and not display it into the browser. eg. We want to display the result of "ping" command but not able to identify what is the … |
| | I have been coding in Perl without using "my" before the variable name.. when should I use MY and why? |
| | Hi All, I am getting the following error below when running my CGI script. I have went through the code but can't seem to sift where exactly it is saying on each of the respective lines. For the error on line 65 is it because I have a localized variable … |
 | So I received awesome help from here before but forgot to ask at the time about one small thing. He taught me how to exclude my "ID" field displaying and about the implode function in PHP but if I display my data using it is there a way to make … |
| | Hello I'm starting to learn c++ and I'm wondering if I should wait until c++0x standard is published (since I'm not in a hurry, currently learning Perl and Java) or should I start learning c++ with an old book I have If i do learn c++ w/ the 2003 standards …  |
The End.