199,114 Archived Topics
Remove Filter  | |
| | I am new to programming and have a question regarding a homework assignment. First off this is for an Inventory Program and it is part 2. The assignment is as follows: Modify the Inventory Program so the application can handle multiple items. Use an array to store the items. The … |
| | I'm developing a Java application where I have to implement Shortest path algorithm (dijkstra's). I've stored the details of nodes in database. But my problem is that the number of nodes is very large (1000+) and taking all the nodes into consideration will increase the time and space consumption of … |
| | Is there a JavaScript script that determines the geographical location of the visitor? I need one to determine that and depending on there location run 1 of about 5 different JavaScript scripts. How do i do this? Does someone know were i can can a script to do this or …  |
| | Hi There, I have a webpage with link of useful websites. Rather than loading the websites in a new window, I would an "inline frame/window" to be opened just ow the link I clicked on so that I can preview/interact with the webpage. Does anyone know how this can be …  |
| | Good day to everyone...I'm a newbie here and a novice in VB6 programming... I really having a hard time formulating the correct syntax on how to merge multiple tables in Access 2003 using VB6. All the tables that I want to merge had the same fields. For example Table1 includes … |
| | I have two Issue using a MDI app. 1-at this moment I'm able to open MDI child forms using the MDIparent except when the I opens form1 I'm also able to open forms 2 and 3 . but I only want one form to be open at a time. 2- … |
| | Hi, i have written a code for getting the environmental variable.I am getting the error as wscript undefined. [code] <html> <head> <title>Test</title> <script language="javascript"> function getEnvironment() { var shell = WScript.CreateObject("WScript.Shell"); var env = shell.Environment("USER"); alert(env("temp")); } </script> </head> <body> <button onclick="javascript:getEnvironment();">Click</button> </body> </html> [/code] |
| | I have to write a function to rotate an image 90 degrees clockwise. I got it to rotate. But it also flipped and rotated counterclockwise. So wrong way, and it flipped along the y-axis. Really weird. [code=python] def rotate(self): rotatedImage = EmptyImage(self.height, self.width) for row in range(self.height): for col in … |
| | I just joint this forum because i know i am going to meet great professionals here,can someone advice me on how to forward my career,i just graduated from Pauls Computer institute obtaining a diploma in computer repairs and wanted to enter and IT institution,can someone advice me  |
| | What I want to do is add a code that makes a picture down loadable. (hope that makes sense) I don't want the picture to appear like what happens when you click on a thumbnail and a larger picture appears. The one I have is 3 mgs in size and … |
| | i have page contain two combo box USA UK GERMANY i want that if i select usa then 2nd combo box will shows only cities of usa plz provide me help |
 | I'm continuing my project and found a strange error, I can think of ten thousand hacks to get around it and a few ways to fix it properly, but my curiousity is peeked. why Is AStringBufEx end result 18 characters long when the Lenth of the initial string is only …  |
| | [I]Hi everybody, I'm new in PHP coding a I want to wrote php script, which find some data in database. But it doesn't work.When I submit form to search, it's write an error: Connection not avaliable! Error 403! localhost 05/27/09 22:33:46 Apache/2.2.11 (Win32) PHP/5.2.8[/I] Could somebody help me? [COde=php]<?php error_reporting …  |
 | I made a project (exe). I want when a user use it , after 6 month or 1 year it will expired. I mean the exe is use for 1 year. after 1 year it will show a msg. like: demo version for 1 year. contact with author. |
| | i am doing a project with visual c++ .In my project I have 2 forms . I want to do some calculation of some data of the form Form1, and i want the result of this calculation to write to a label of Form2. How to do this? |
| | Can anyone lease tell me the value of k? I know it starts at 0 and loops backwards but I can't figure out where it terminates. I would really appreciate someone telling me the best way to figure this out so I can solve these problems in the future [code] …  |
| | OK so I have this WebBrowser1 and Button1 controls. After you click Button1, program will access website, takes some HTML data, removes unwanted HTML tags and then WebBrowser1.Navigate("about:blank") + writes my HTML to the blank page. Everything works great until.... Until you click the button 2nd time. Then you'll get … |
| | I am an not so experienced developer and could od with some help. The problem I am trying to tackle is as follows: I would like to enable the site-administrator, when logged in, to renew the occupancy calendar of a holidayhome in Mysql. The occupance file on the desktop that … |
| | Hello, I need some help if anyone has an idea. I'm working a memory management simulator trying to implement a mark & compact algorithm. To do that I need a function that can move/copy a block of memory from address A to address B. I tried using [CODE]memmove (dst, src, … |
| | Hi, I've been asked to create a proof of concept for a new database tool we need to develop, combining various existing databases. It’s been awhile since I’ve touched any database work and I’m a little unsure how to go about it. Let me explain the problem...the analogy I’m using … |
| | I am having problem getting all the links from a webpage. I have successfully created this using just C#. I used [code] foreach (HtmlElement link in webBrowser1.Document.Links) { string linkItem = link.GetAttribute("HREF").ToString(); [/code] Apparently C# in ASP.net doesn't have System.Windows.Forms so I can't use HtmlElement. I've tried a couple of … |
| | I have a large file to read to get the data out of the columns. File size varies, but is usually around 1000 to 3000 lines. What I need to do is pull the data(numbers) from column 3 ONLY if the number in column 4 of that same line is … |
| | I do not understand what I am doing wrong... I need the second triangle to print the character the user inputs, but instead - and I have no clue as to why it is doing this - it prints the second triangle with smiley faces and other symbols. Any help …  |
| | [CODE] private void cmdSales_Click(object sender, EventArgs e) { backgroundWorker1.RunWorkerAsync(); timer2.Start(); } private void timer2_Tick(object sender, EventArgs e) { TimeSpan ts = DateTime.Now.Subtract(startDate); string sTime =" ..." + ts.Minutes.ToString("00") + ":" + ts.Seconds.ToString("00") + ":" + ts.Milliseconds.ToString("000"); toolStripStatusLabelTime.Text = sTime; if (toolStripProgressBar1.Value == toolStripProgressBar1.Maximum) { toolStripProgressBar1.Value = 0; } toolStripProgressBar1.PerformStep(); } …  |
| | Dear Guys, I am Simone from Rome. I have a problem. I need to write an algorithm for the encryption of data, and to implement it I need to work with integer numbers of about 100 ciphers (for example I need to make a multiplication between 2 numbers of 70 … |
| | Today I had this question in my exam: [CODE]write a program in C++ that covers the next points: -a company needs to enter its employees' data into the computer -each emplyee has (ID-Job Code-Division Code-Salary) -should be done using struct -Input/Output functions should be inside the struct -use the struct … |
| | Could someone explain how to get to the answers. I read the book from class and cannot find the answers to the last 3 problems. I am not asking for the answers, just how to figure to resolve the problem. I appreciate the help. Consider the following selection statement where … |
| | Hello Im trying to create a order form which passes through multiple pages. Im wondering if you could have a drop down menu with the prices on and names on from a MYSQL database. Thanks |
| | Hi, Can someone please help me. I am getting error: The process cannot access the file 'c:\reports\PaymentDetailReport.xml' because it is being used by another process. in following function. This method is suppose to be called couple of times. but at second time, it throws the error. I have even closed …  |
| | Hi, First-timer here. Have JS that works in Safari, IE but not FF. Very simple code: [code] <script> function callFunction() { if (eb.TobaccoProds.checked == true) { eb.action = "step2.php"; } else { eb.action = "passthrough.php"; } } </script> <form id="eb" name="ebr" method="post" action="" onsubmit="return callFunction();"> [/code] When user clicks (or … |
| | Hi, I have a problem with the tolower function. I use Netbeans 6.5 with GCC C++ on Ubuntu 64bit. The problem is, that I use nordic letters like å, ä and ö and the tolower function does not affect them at all. I have tried almost everything. I have tried … |
| | Hi I'm trying to create a dialog box with GenBitmapTextButton buttons. When I create the dialog using the standard button, I can use the enter key to push the button, and the escape key to cancel the dialog. However, when I use the GenBitmapTextButton, neither the enter nor the escape … |
| | Hi guys, new to the forum so i hope that my first topic wont be full of errors. Anyway, i just started programing a couple of weeks ago in a program at my elementary school, and i have a couple of Q's. so this is my prog. [CODE] if(ima == … |
| | Hi all, I have a very easy question (I think, at least), but I can't for the life of me figure it out, which makes me feel stupid. I'm trying to make a function to generate buttons (I have quite a few buttons in my app and don't want to … |
| | ok so i have this code to start with javascript [CODE] if(document.createElement) { //W3C Dom method. var tr = document.createElement("tr"); var td = document.createElement("td"); var input = document.createElement("input"); input.id = field+count; input.name = "the"; input.type = "text"; //Type of field - can be any valid input type like text,file,checkbox etc. …  |
| | Hey everyone, I have the following data set A B C D E F G H I J K L M N O P Q R S T Where every ten lines or so (though not a regular pattern) the data breaks its format and two of the data pieces … |
| | Hi all, I am using Visual Studio 2005, and developing some application. Currently i am facing one problem. I have written a class and declared some member variables in the class. In the constructor i am initializing the member variables to 0(member variable is int). But when i debugged the …  |
| | This is a basic piece of code that write a couple of links to the webpage: in the xhtml file (1.0 Strict): [icode]<script type="text/javascript" src="file.js"></script>[/icode] in the file.js file: [code=JavaScript]document.write("<p><a href="link1.html">Title</a></p>"); document.write("<p><a href="link1.html">Title</a></p>"); document.write("<p><a href="link1.html">Title</a></p>"); document.write("<p><a href="link1.html">Title</a></p>");[/code] The links aren't there, the titles are there, THERE IS NOTHING THERE!!!!! =/ |
| | Hi , I am trying to bind a drop down and checkbox with values from two tables from database. The 1st table has categories and is binded to the DDL and the 2nd table has sub categories and is binded to checkbox and inter related by using the category ID … |
| | [i](Im using VS C++ EE 2008)[/i] Hi people, i have had a strange problem today. Im currently programming something to do with Physics. I have searched the Internet already for the answer, including this site. The problem is: [i]error C2064: term does not evaluate to a function taking 1 arguments[/i] … |
| | hi guys.. i'm doing this program.. haven't finished it yet.. i'm not getting any errors but the program is not running correctly.. I dunnu y,, i did everything i had to and it says 1 succeeded with no warnings ! here is my code.. [CODE]#include <iostream> #include <fstream> #include <cstdlib> … |
| | Note, some of the code could be hard to understand as a bit is in Swedish. Hi! I am trying to learn some sql/java. I created some tables in an sql-database, and a java-program to access and modify the tables. I am not that experienced in programming so I might …  |
| | PLEASE PROVIDE ME A WAY TO PUT A JSP OUTPUT IN PDF FILE........ ACTUALLY WHAT I M DOING IS THAT......... There is a JSP page which displays charts (bar,pie) of students (name and marks ) from database ,,i want that this chart output also display in PDF file... pls help |
| | I have a text file with something like this in it: >ENSG00321 Gene_ch19 . . . . AATAGCGGTTAACATATTAATTAAACTAATGTATAGATATTATCCGCTTCCAGATTTATTATTTTGTAAA ATAGGCACAGTTCTTATCTGGTGTCACTTTATGCTTTTTTAATAGACGCCCAGCTCTACTCATGGCCAAG . . >ENSG00531 Gene_ch5 . . . . AAAGAAGCGTAGGCCCGCCATGCAGCGTAAAAAGGATAATGCGGAGCAGCGGTCCCCAAAGACTGATTTA TCAAAACTGTTTTCGCAGCAATTAACACACCCACCGACCAGTAACACCGCTGCAAGCAAGGCCACGGGCA . . I have some headers like (ENSG00321) too. I want to search in text files with header and then get … |
| | Hi I was wondering what the syntax would be to have a left join from one table to a resulting query without the view. Currently I use a view and it works fine but I was wondering how to achieve this without creating the view. Here is the current view's … |
| | Hi, I want to create a sequence of vector<double> each with a name + a number that goes from say 0 to 9. For example, how do I make a loop that creates10 vector<double> that goes by the name : vector_0, vector_1, ..., vector_9 ? Thanks.  |
| | First let me say thanks to everyone who has been responding to my posts and providing valuable insight. I have been trying to add rep whenever possible, and appreciate your help. My assignment was to write a python code which takes data from an infile, then has the user specify …  |
| | This is the hex output from a LARGE_INTEGER. "EA 00 0B 00 A1 00 00 00" On my machine a DWORD is read "00 0B 00 EA" How do you place the high 32 bits in the sequence? This leads me to the question of how to output this to … |
| | Dear All can we filter subset of DataSet.Table row collection in ADO.Net. Early days adodb's recordset was providing Filter method to get subset of its records, but i couldn't find a similar option in ado.net. thanks in advance and looking for your immediate suggestions Warun |
| | SEVERE: IOException while loading persisted sessions: java.io.WriteAbortedException: writing aborted; java.io.NotSerializableException: com.sun.mail.pop3.POP3Message I am not getting why this exception has occurred.It throws the exception when i starts tomcat server. I have used recieve() method in LoginAction which is used to recieved mails using POP3 protocol. I am using JAVAMAIL 1.4 |
The End.