199,114 Archived Topics
Remove Filter  | |
| | Im doing this game for school and it's supposed to be finished real soon and then of course al the problems start coming up, the game now crashes, sometimes after a few seconds and sometimes directly on start. Don't really know why, a thought is that its doing to much … |
 | In this program I am writing for class, I have to make a Paper Rock Scissor game using functions. I got everything written and everything seems to work until I quit the program and it's supposed to display the stats. It seems that the variables arent storing and being passed …  |
| | Hi , I am a final year student, looking for some ideas for my final project. I had an idea of an audio processing program - it will get the notes out from a closed audio file. Does it sound too hard? impossible? My lecturer says that audio processing is … |
| | Hi, I am making a richtextbox to html convertor, I have added features like bold italic underline left align right align center align etc. I found a code to convert richtextbox to html but i am not sure how to use that function. Public Shared Function FromRtf(ByVal rtf As RichTextBox) … |
 | Hey guys, Writing a project for school and having a little trouble. We are creating a social media program and the teacher never taught us to use databases so we have to store all the data in text files. One of the requirements is to for the users to be … |
| | Hi Friends I have just started learning Java.I am getting a problem may be a small one but i coundn't able to figure it out.so here is my Servlet code iam trying to insert data into database after submitting form iam getting **java.lang.NumberFormatException: For input string: ""** I want to … |
| | Hi guys, I am implementing a website using jsp. And I am using <input type="file"> to read files from user. I want to use the same name attribute to get an array of fileproperty, but it doesn't work. Does anybody how can I do this correctly?  |
| | i am tring to debug this problem for about a week but had no luck in it.  Take a look at this image above. This is how i want the bullets to look like. shoot red lines.  Now take a look at this image above. I …  |
| | Hello, I'm trying to create a program that installs a directory and then runs some commands in a console of that directory that is installed. I think I could manage doing running the console commands, but I'm having a real hard time in trying to make my program install the … |
| | This is my first PHP script, to add a user to my website but i keep getting these errors Cannot send session cache limiter - headers already sent Cannot modify header information - headers already sent mysql_num_rows expects parameter 1 to be resource boolean given I have a basic understanding … |
 | Hi Everyone...!! Last Week, I Was Assigned A Project Of Building A Mine Sweeper Game In Console.!! I Start Working On It But I Don't Have Any Idea From Where Should I Get Started..!! I Want To Add Some Simple Graphics In My Game, But First I Want To Make … |
 | **Write a C++ program that will make use of the following structure and The typedef Statement: typedef int ArrayType[MaxSize]; The structure is the OneDArray structure, which contains the following data items: a- Name of array. b- Size of array. Use dynamic memory allocation (dynamic one-dimensional array) for storing positive numbers … |
| | Ok, I'm not sure how to format the readline to skip the header columns of the file that is being read in the code that I wrote/spliced in my class. I was wondering if anyone can point me in the right direction here. Thanks in advance! Private Sub btnLoadFromText_Click(ByVal sender … |
| | I have to accept user input, a string, into a doubly linked list and print the output reversed and forward. My professor gave us the following program and told us to modify it. However, I cannot figure it out. /* Program to reverse a doubly linked list */ #include <stdio.h> …  |
| | hi, how to write javascript code to validate first 2 textboxes that are generated from databses without "id" "name". eg:here everything comes from databse. name:<input type="text" id="{id}" name="{id}" class="textbox"/> "+" this feilds are generated with + button from database age:<input type="text" id="{id}" name="{id}" class="textbox"/> this does not have "+" here … |
| | i got this problem from: http://codingbat.com/prob/p178318 This is the question: > Given a string, return the count of the number of times that a substring length 2 appears in the string and also as the last 2 chars of the string, so "hixxxhi" yields 1 (we won't count the end … |
| | I got this assignment from my teacher the other day and i am having a hard time understanding it. I asked him for help and im even more confused. **I AM NOT ASKING FOR YOU TO DO IT. I AM ASKING FOR ADVICE AND HOW TO DO IT** Write a …  |
| | I'm trying to take a file that looks like this: >taxon1 ACCGTGGATC CCTATTGATT GGATATTATC >taxon2 TTCATATGTA GGATTTCATA GATGGCCCCC And get it to look like this taxon1 ACCGTGGATCCCTATTGATTGGATATTATC I'm using a python script, so far this is what I have: #!/usr/bin/python import sys if len(sys.argv) < 2: print "usage: finalmyscript.py infile.txt" …  |
| | how do you write a code that calls the newline() funtion? |
 | Hi All, Help me please. I want insert to people_go table using checkbox. data.sql CREATE TABLE `people` ( `id` int(11) NOT NULL auto_increment, `p_id` varchar(20) NOT NULL, `name` varchar(50) NOT NULL, PRIMARY KEY (`p_id`), KEY `id` (`id`) ) ENGINE=MyISAM DEFAULT CHARSET=utf8 ; INSERT INTO `people` VALUES (1, 'P001', 'Ana'); INSERT … |
| | I'm having trouble with cross-browser compatibilty with a jQuery click function. I want it to return the width of #bbox and have it play the animations based on what it returns. I have set the width of #bbox to 0px in my CSS as the starting state. THE PROBLEM: w …  |
| | PM bmx322 Hi All, I am integrating JFormer with CI. I am able to get the form to build but the validation doesn’t work and there are no POST vars nor any values in the jformer formValues on submission. I load the JS files in a header template and have … |
| | Hello, I'm trying to make my maze game object-oriented. The problem is my mazeArray. I'm a bit confused on how to use it correctly to draw out my maze. Map.h: #include <stdio.h> #include <stdlib.h> #include <windows.h> #include <process.h> #include <cstdlib> #include <ctime> using namespace std; #pragma once class Map { … |
| | Hello. I have a listbox that I would like to display and I would like to set a default selected item, which I will not be able to determine until run-time. Is it possible to set a default item in the program code? I have looked at the Index property … |
| | Hi!I have a project with me which contains this html editor user control designed by someone else. I want to use this control in my project but I don't know how to copy it to my project. Please help me. Attached is the project from which I need to copy … |
| | this time I have only one textfile and I want to remove all duplicate lines so that each and every single line in it is unique unto itself. with open("textfile") as w: for line in w: W = line with open("textfile") as d: c = 0 for line in d: …  |
| | i want to find the total space used for the files owned by me from my current directory. i have du -sh `find ./ -user $USER -type f` which gives 8.0K ./.a 8.0K ./t 4.0K ./cat/A 4.0K ./a using -s has no effect. using du -sh by itself includes the … |
| | I am pretty new to Visual Basic, I will be going to programming school soon. As for now, I don't know really anything. Now to my question. I have a couple files I want to install into the C:/ directory. They're all put into a folder. I typed in this … |
 | Hi I would like to know :- 1. after developing a program with vb 6 then I would like to run the setup n install it in different computer,but when i run it adodc not connected with database Can I connected adodc in my computer ? Because my intention is …  |
| | Hi, My problem is, the Update query process is painfully slow. Every time user updates a value to a column, it is taking more than 1 min ! I have to update a cerain field Yes/No based on some other field values from the same table. Below is my code: …  |
 | Hello. Please guide me about how to get the options of select tab from mYSQL table. Where to insert php code and how to? Have a look on the code. <td><select name="tby" size="1"> </select></td> <td colspan="2"> </td> </tr> <tr> <td colspan="4"><label>Issue/ Tests : <textarea name="issue" wrap="physical"></textarea> </label></td> Regards. Aamir Karim. |
| | i am working through an purchase & sales report.i want to display the purchase report for daily basis using rdlc report how can i do that...can any one help me.....i use date.today to pass in database to fetch the record but how to display that record in report.. sqlcommand=" select … |
| | I'm trying to execute a binary on my Linux web server. The binary is called 'phantomJS' which is used mainly to create screenshots of a webpage. I logged into my cPanel and found the following information about my server: Operating system : Linux Architecture : i686 So I went ahead … |
 | map<string, vector<int> > // 42 xref(istream& in, // 43 vector<string> find_words(const string&) = split) // 44 error: [errorPic](http://s13.postimg.org/3y4vgjdev/compiler_error1.png) this is a cross-ref program that's written in the book, the exercise told me to create an improved feature for it. So, before I start with my work, I need to organise … |
| | i am creating my user interface by using multiple panels in same form. placing them one after other. each panel visibility is controlled by the button. i am having trouble controlling the visibitity of panels. even BringToFront method isn't working |
 | I have revencly experimented with backbone, but did not use in real project yet. WHen I have oportunity I will try at work. Now considering what to study next. I hear lot of node.js is cool. But really don't understand why should I learn it. I tried googling, reading stackoverflow … |
| | i am new to spring framework. i have learned basic concept of Spring.Now i am trying to simply run one hello world application using spring. i am getting following error.i dont know why? i am using netbeans 7.2 and spring framework 3.1.1 Release. **hello.java** public class hello { private String … |
 | hi everyone :) im trying to open this project , but when i double click it , vs2010 opens with error on the forms. double clicking the forms shows that the file doesnt exist at the particular directory , even when its visibly there. its probably a trivial thing , … |
 | void boss_animation() { for (int i = 0; i < 4; i++){ if( ! boss[i].drawable) continue; //Puts image of character on screen based on inputs from struct readimagefile(boss[i].frames[boss[i].currentFrame], boss[i].xCoord, boss[i].yCoord, boss[i].xCoord + boss[i].charWidth, boss[i].yCoord + boss[i].charHeight ); boss[i].currentFrame++; //increments the "frame" by one, thus only animating one image at a … |
 | I've done the following code but I can't figure out how to get an output to come out; I used a structure to store both strings and doubles, and then created an array using that datatype. However I can't work out how to create an output. It wont let me … |
 | Hello guys, i'm new here. I would like to convert my .txt file which have the following content into an array of int which every elemnt in the array should only have 4 character inside. example: two[1]= 0x03; two[2]= 0x00; two[3]= 0x03; two[4]= 0xf5; This is the content of my …  |
| | does bool work in c(by this i mean a data type that can take only two states 0 or 1 in order to save memory)? if yes then is it included in stdio or any other file is required to be included? same doubt for c++ also mention the syntax … |
| | Hi Guys, My website is showing the default screen we normally get when we buy a hosting account the first time. I have attached the screenshot. I tried to modify the web.config file. Still it doesn't change at all. i had uploaded my files and it used to work for … |
| | i am creating website in that site i have to run news alert through javascript through event mouseover and mouseout plz help me how to perform that task in javascript? |
| | Okay so basically my problem is that I have to prompt the user for a set of floating point values once . If they do not enter the right data type then I have to prompt them again. If they dont enter the right type the second time I quit … |
| | Hi there, Looking for some desperate help with a problem I am encountering. I have a third party product (bentley Geo Web Publisher) that allows you to specify an xslt to transform some tabular content into a HTML page. Everything worked fine until a couple of weeks ago when I … |
| | Hi I'm trying figure why I'm getting this error **Undefined offset: 1**. I'm practicing with **list()** function and with a **explode()** function. When I ran the code it kept mention this error: Undefined offset: 1 The line is this: list($bagsize, $candyprice)=explode("#", $_GET["size"]); The list is not an array. It's on … |
| | I want to know how I can implement a function to open a file and read its contents into a linked list, and then print the contents reversed #include <stdio.h> typedef struct stack { char b[100]; int top; }stack; void push(stack *s,char k) { if(s->top==99) printf("\n Stack is full "); … |
 | The model is not overly complex. It has a list of items each of which is generated in its own form with its own submit button. Each submit button has its onw id. The first form returns what I need. When I view the results from the form, if I … |
| | I have navigation, with a dropdown subnav that gives them two options (level 6 and level 10). If they click on one or the other, it loads "views.php" then uses .html to write the correct information to sections. The img src portion isn't working??? I also tried just using .html … |
The End.