Software Development Forum

my assignment was to create a calculator using either if statements ir switch methosd i opted for the switch method. everythign compiles but when I type in two integers this is what comes up:Enter two integers to be calculated (separate using space): 2 3 Exception in thread "main" java.lang.NumberFormatException: For …

So i had to write a program that uses these functions to add, subtract, multiply and see if the numbers equal each other. and also You must create a way to keep track of the relationships between friends, the spouses, the siblings, the children of the men and women. attached …

Hi guys. I'm in a beginning C# class and I' having trouble with an assignment. I need to make a windows forms application that takes English text from a text box, converts it to Pig Latin, and then returns it to a second text box. The specifications are: If a …

Hello, I have this code that's giving me some problems: [CODE]import java.util.Scanner; class Bæreevne{ public static void main(String[] args) { int avstand, vektTre, vektBetong; Scanner tastatur = new Scanner(System.in); System.out.print("Oppgi antall meter mellom søylene"); avstand = tastatur.nextInt(); vektTre = 3000 - 20*avstand*avstand; vektBetong = 7000 - 80*avstand*avstand; if (vektTre > …

I would like to know what is the correct format of virtual path on vb.net or vs 2010. In my project folder, is it advisable to save it in bin folder? If yes, what will be the virtual path of it?

I'm having trouble with the 3rd if statement of my code if(select == 3). Here, if the user selects '3', then they should be able to search for students (given that students have already been inputted), via their ID. The ID that is searched and the subsequent Name relating to …

I have a C# App with a form which has a groupbox containing many controls. I have the groupbox anchored Top/Bottom/Left/Right to ensure that it sizes appropriately to the users screen resolution. This app was developed on a machine running Windows XP and it has been working flawlessly for over …

I'm trying to make a function to insert a few integers into a sorted vector and display the integers in decreasing order. Actually is from my college tutorial question. Not that i don't want to ask my lecturer but i'm trying to learn myself how to solve the problem and …

well...i tried in google...but actually i didn't quite get it. :) [url]http://www.thinkage.ca/english/gcos/expl/c/lib/fflush.html[/url] in the above link they are saying, user should definitely NOT write code of the form [CODE]printf("Prompt: "); fflush(stdout); gets(s);[/CODE] but before we used fflush after printf...for example [URL="http://www.daniweb.com/forums/post1168561.html#post1168561"]here[/URL] jephthah gave a solution where he used fflush after …

hello , i am using PyQt4 : QtCore and QtGui . i built a GUI with few tabs using QTabWidget(self.centralwidget) and addTab(self.device) device is a QtGui.QWidget() device is one of my tabs... i send text to this tab with self.ui.name.setText(' ....') (name belongs to this tab) how can i clear …

I am using a ListView control in my VB Form and I want to save all the data in my ListView control. It has 2 columns and the number of rows can keep increasing depending on the user. Please help me with this query. Thanks in advance.

I wanted to know the advantage of consts over macros. And I found the line "The main disadvantage of macro is it doesn't do type checking.". Is it not an advantage of macro? So that I can #define any constants without a limit. Can you pls explain me why it …

hi, i wrote the following piece code to create a new bitmap file with random RGB values. I wanted to copy the header from the input file. the problem is it adds two additional bytes to 3rd and 4th (just after the magic number). i can't figure out why. // …

I will be interviewed Monday or somewhere along the school week, to take an IB Computer Science course. I told the teacher that the programming class I had was a bit too essay and told her I had experience in C++, C# , VB, and python (basic). But I will …

Hi all, I want to show Form2 when button1 of Form1 is clicked. how would i do it. this is what i was trying to do.But it is not working But it gives me an error ; The event 'System.Windows.Forms.Control.Click' can only appear on the left hand side of += …

Hi, i am creating a windows application in c# while making an exe i want to add setup of sqlexpress. how i can add this so it will install when package is install. I have add prerequisties in properties to add windows installer,.net framework,sqlserver but it seems to be not …

Hi guys, I want to export the record according date range with visual basic. And the date range will be using 2 date time picker to choose. Can anyone give an idea how to do it? Thank you.

I am designing a project geared towards business and is built in C language. The design of the various interface screens are currently in XML/CSS. The target platform is a PC running linux or windows. To compile the software, I first run a source-to-source compiler which converts the XML/CSS into …

Hi this is my first post, but I've lurked for a while usually finding answers to my questions in other threads, I couldn't find this one so I broke my posting cherry to ask. I know I'm missing something, probably really simple, but possibly I'm doing this completely wrong. I'm …

iam building a training set for spam filtering using java,training set data is given as words in text files in one folder,but im unable to debug whats going wrong in java collections [CODE]/* *folder part 1 conatins various text files having name format * **spmsg***.txt and ***legit***.txt e.g 11927legit569.txt ,106127spmsgc26 …

hi. i just want to ask how can i populate a listview n vb.net that has a is limited by a date from and date to. i have a datetimepicker for start date and datetimepicker for end date and i want do list all the entry of my database in …

i need to add explanation to my file i have a little filesystem in my program (so i dont want to use database for files) how can i add and call explanation to myfile i have some ideas but thats last resort couse its not not efficient and hard to …

Well I just got a new latop with windows 7 and downloaded textpad 5 to do my java homework. At first I had issues just trying to compile but then found out that i needed to point textpad to javac.exe for it to compile. Now my problem is i cant …

Hello, It seems like every time I start a new project with classes I have trouble with this. I am getting an error "undefined reference to 'Item::Item()' I'm sure I am overlooking a simple mistake. I have been looking at this for an hour and I cannot seem to find …

I have to calculate the number of days between two dates the hard way. I know there is already a way to do this with an existing package and such but I have to do it within a single method "daysBetween" without altering any other part of the code. The …

In my c++ class we are assigned to make a piglatin translator. I haven't had much experience with c++, but I've done quite a bit of programming in other languages. My main question would be what functions are available in c++ to handle strings and change them? I have a …

I've created two dialogs in which Dialog1 is the parent of Dialog2. After navigating to dialog2 if i press close button in Dialog2, Dialog2 is closed but Dialog1 is displayed. Again i've to press the close button in Dialog1 to close the application (i know this happens coz. the close …

The Rugby World Cup Organizing Committee has decided to embark on a project to automate their score board keeping for rugby world cup games results. This program would be tested and used in the current World Cup and then later could be used in the major rugby tournaments around the …

Well I'm making a program where multiple images will be used but I don't know how to make the images transparent, since Delphi is only allowing me to use .jpg images instead of transparent .png images. It ends up giving my images a white sqaure block around them and ruins …

i have ADO connection in MS Access, when i tries to execute con.execute command, MS-Access gives error like MS Access encounter serious problem and needs to be closed. any help or suggestion. thanks in advance

Hello, what's the best way to sort a string to ints & chars. For example: "John Doe M 36" to John Doe (char[]) M (char) 36 (int) I researched about istreamstring sin(), but I'm not yet fully familiar with it, any tips. Thanks!

Hi im trying to make a program that passes an array to a method. the method then finds the smallest number in the array and passes that number back to the main where its printed out. I am getting an error saying: "error: number cannot be resolved to a variable". …

I am trying to get this to work and am stuck. I run a JUnit test and get a few failures. Can someone show me the way to make this work? [CODE] /** * int numberOf(String s, String characters) * * Returns the number of times any of the chars …

I thought I knew this but I don't. Currently I use RegCreateKeyEx to create a key, and then I call RegSetValueEx. Now what happens is that I create another key (folder in the regedit GUI), and I set the default value for that key (folder). But how do I add …

hello so i have this problem that i can't solve and i need ur help. im making a program that makes the user move the fish and there is a shark at the end that he tries to avoid. here is the code [CODE] kik="b.jpg" kif="kf.jpg" kis="sss.jpg" #these are pictures …

#! /usr/bin/python import socket import struct import sys import os import string #MADDX = '225.100.100.100' MADDX = '224.0.0.103' RAW = False #! /usr/bin/python import socket import struct import sys MADDX = '224.0.0.103' ADDR = '' #bind to address? leave blank for any DATA="414e542d534541524348204d4441502f312e310d0a3436" #the Hello ID request import binascii SDATA …

ok so here is my code so far: [CODE]using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace PracticeReview { class Program { static void Main(string[] args) { const double TAX_RATE = 0.0675; const int SPEED = 80; const char HIGHEST_GRADE = 'A'; Console.Read(); TAX_RATE = 0.0675; SPEED = 80; HIGHEST_GRADE …

Hi, I have the data file. txt (3.96 MB) and I want to make each 50 Character on the one line. For EX: In put data : [CODE]GTGAGCCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCGATCTC........ [/CODE] [CODE] out put with 50 character on one line: GTGAGCCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCC TGAGCCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCG GAGCCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCGA AGCCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCGAT GCCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCGATC CCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCGATCT CAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCGATCTC [/CODE] Below is my script …

I've use to create this in Turboc++ 3.0 and there are four linker error how could i fix this? [CODE]#include<stdio.h> #include<graphics.h> #include<conio.h> main() { int gd=DETECT,gm,col=0; initgraph(&gd,&gm,"c:\tc\bgi"); while(!kbhit()) { setcolor(15); circle(col,100,50); col++; if(col>=600) col=0; cleardevice(); } }[/CODE]

I'm trying to store these arrays into the matrix [CODE]double X[5][3][/CODE] so I could classify them with 1 Nearest Neighbour: [CODE=C]double brick_v[3]={ent_brick,en_brick,con_brick}; double metal_v[3]={ent_metal,en_metal,con_metal}; double skin_v[3]={ent_skin,en_skin,con_skin}; double wood_v[3]={ent_wood,en_wood,con_wood}; double grass_v[3]={ent_grass,en_grass,con_grass};[/CODE] I would be very grateful if someone would show me how you can do this in C++.

Not asking for code, but I'm wondering if anyone can give me some advice and pointers for writing a code that reverses an inputted int, without using the string reverse.

A friend of mine made this script to backup files from all my ubuntu boxes using lftp to an ftp server i setup on my local windows 7 machine using apache and abilityftp server. However it is only backing up some config files(see attached screen), none of the actual directories …

Let's say I have a string with 1+5*9+4 etc.. whatever it may be. How do I use C++ do calculate this? I know recursive functions work here, but how? I figured I could loop ..searching for the * first ( higher precedence ) and then the +. No idea. Would …

Hi! I am thinking of starting a program for a java enabled phones or smartphones... I am a beginner there for i don't have advanced knowledge of such programming... So heres my requirements; 1.the code should be able to run in netbeans 2.step by step process with explaination for understanding …

Dear, Currently i'm doing a project to design a chatting program using MFC( Microsoft Foundation Classes) and Visual Basic (VB). Just wondering, could you help me with this topic? Your attention kindly appreciated. Thank you.

Hi, I wanted to know what does the ("{0}, {1}" signify in : [CODE]Console.WriteLine("{0}, {1}", mixedCase, lower);[/CODE] Couldn't find it on google at all. Thanks for everything!

In Windows, events are kernel objects. I am thinking that because of this, they should be accessible across processes, given each process has security access and the name of the handle. Another engineer argued with me that they are used only within processes...but I believe he is wrong. Anyone know …

Note, I screwed up and asked how to get DisplayMember text, I meant to put ValueMember... I have a combo box I'm populating from a datatable. It has two columns, one for display and one for value. I can find the index of the associated item in the combobox list …

never mind

I am having trouble with the standalone builder I keep on getting this Message: [CODE] I: Dependent assemblies of C:\Python27\python.exe: I: x86_Microsoft.VC90.CRT_1fc8b3b9a1e18e3b_9.0.21022.8_none checking Analysis building Analysis because outAnalysis0.toc non existent running Analysis outAnalysis0.toc Analyzing: C:\Users\Samarth\Desktop\PYINST~1.1\support\_mountzlib.py Analyzing: C:\Users\Samarth\Desktop\PYINST~1.1\support\useUnicode.py Analyzing: C:\Users\Samarth\Dropbox\Projects\DATABANK\data-bank.py W: library coredll.dll required via ctypes not found I: Analyzing C:\Python27\python.exe …